ORFeome > rab40b ORF1 – XORFeome v1.0

rab40b ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rab40b
Gene ID: 865977
Gene Page ID: 490553
ORF Xenbase ID: 17292195

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078543
Original XGC clone length: 837

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ839628
dbEST ID: 79657330
Trimmed Sequence: ATGACCCACAGAGCCAGCCCAGCGAAAGCCTATGACTTCCTTCTGAAGTTCCTTTTGGTTGGGGATAGTGATGTTGGCAAAGGAGAGATACTGGCAAGCTTGCAGGATGGATCCACAGAGTCGCCTTATGGTTACAATATGGGGATCGACTACAAGACAACCACAATATTACTGGATGGTCGTCGGATAAAGTTACAGCTCTGGGACACGTCGGGGCAGGGAAGGTTCTGCACAATATTTCGCTCCTATTCGAGGGGTGCTCAGGGTGTAATTCTGGTGTATGACATCACAAACCGCTGGTCGTTTGACGGGATAGATCGGTGGATTAAAGAGATAGATGAGCATGCTCCTGGGGTGCCCAAAATCCTGGTGGGGAACCGGCTTCATTTGGCCTTTAAACGGCAGGTGTCAACAGACCAAGCACAAAACTTCGCTGAGCGGCTCGGCATGACATTCTTCGAGGTCAGCCCCCTGTGTAACTTCAATATCACGGAGTCGTTCACTGAACTGGCACGGATAGTTCTAATGAGACATGGGATGGACCGACTTTGGAGGCCCAACAAGGTACTGAGTTTACAAGACCTCTGCTGCCGAGCCATTGTATCCTGCACCCCAGTGCACCTCGTGGACAAGCTTCCTCTCCCTGTTGCCTTAGGAAGCCTTTTAAAATCGTTTTCCATGGGCCAATGGTTTGAACGCCAGAATGATGCATGGTCGCTCCTACTCGCTGACTGCCAACAACACCAAACAGAAGAAACAACCCTCAAAAAAGCCCAAAAACCATCCGTCCCCCCTTAAAAGCCCCCCCAAAGAAGTTGA
Full Trace Sequence: CGCGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCCACAGAGCCAGCCCAGCGAAAGCCTATGACTTCCTTCTGAAGTTCCTTTTGGTTGGGGATAGTGATGTTGGCAAAGGAGAGATACTGGCAAGCTTGCAGGATGGATCCACAGAGTCGCCTTATGGTTACAATATGGGGATCGACTACAAGACAACCACAATATTACTGGATGGTCGTCGGATAAAGTTACAGCTCTGGGACACGTCGGGGCAGGGAAGGTTCTGCACAATATTTCGCTCCTATTCGAGGGGTGCTCAGGGTGTAATTCTGGTGTATGACATCACAAACCGCTGGTCGTTTGACGGGATAGATCGGTGGATTAAAGAGATAGATGAGCATGCTCCTGGGGTGCCCAAAATCCTGGTGGGGAACCGGCTTCATTTGGCCTTTAAACGGCAGGTGTCAACAGACCAAGCACAAAACTTCGCTGAGCGGCTCGGCATGACATTCTTCGAGGTCAGCCCCCTGTGTAACTTCAATATCACGGAGTCGTTCACTGAACTGGCACGGATAGTTCTAATGAGACATGGGATGGACCGACTTTGGAGGCCCAACAAGGTACTGAGTTTACAAGACCTCTGCTGCCGAGCCATTGTATCCTGCACCCCAGTGCACCTCGTGGACAAGCTTCCTCTCCCTGTTGCCTTAGGAAGCCTTTTAAAATCGTTTTCCATGGGCCAATGGTTTGAACGCCAGAATGATGCATGGTCGCTCCTACTCGCTGACTGCCAACAACACCAAACAGAAGAAACAACCCTCAAAAAAGCCCAAAAACCATCCGTCCCCCCTTAAAAGCCCCCCCAAAGAAGTTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCCACAGAGCCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839627
dbEST ID: 79657329
Trimmed Sequence: GGAGATTTTGCAGCTGTTTCTGGTACAGTTTTTTGGGGGGCTTTGAGGGGGACGGATGATCTTGGCTTTTTTGAGGCTGTTCCTCTTGTTTGTGTTGTTGGCAGTCAGCGAGTAGGAGCGACCATGCATCATTCTGGCGTTCAAACCATTGGCCATGGAAAACGATTTTAAATGGCTTCTTAAGGCAACAGGGAGAGGAAGCTTGTCCACGAGGTGCACTGGGGTGCAGGATACAATGGCTCGGCAGCAGAGGTCTTGTAAACTCAGTACCTTGTTGGGCCTCCAAAGTCGGTCCATCCCATGTCTCATTAGAACTATCCGTGCCAGTTCAGTGAACGACTCCGTGATATTGAAGTTACACAGGGGGCTGACCTCGAAGAATGTCATGCCGAGCCGCTCAGCGAAGTTTTGTGCTTGGTCTGTTGACACCTGCCGTTTAAAGGCCAAATGAAGCCGGTTCCCCACCANGATTTTGGGCACCCCAGGAGCATGCTCATCTATCTCTTTAATCCACCGATCTATCCCGTCAAACGACCAGCGGTTTGTGATGTCATACACCAGAATTACACCCTGAACACCCCTCGAAAAGGAGCCAAATAATGGTGAAAAACTTCCCCTGCCCCAAGTTGTCCAAAAGCTGTAAATTTAATCCAAAAACCATTCCGGTAAAATTTGTGGTTTTTCTTGTTAATTCAATCCCCCCAAATTGTAAAACATTAAAAGGCGGACCCCTTTTGGGAATCCTTCCCGTGAAAGAGCGTTGTGC
Full Trace Sequence: GGGGAAAAGGCTTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGATTTTGCAGCTGTTTCTGGTACAGTTTTTTGGGGGGCTTTGAGGGGGACGGATGATCTTGGCTTTTTTGAGGCTGTTCCTCTTGTTTGTGTTGTTGGCAGTCAGCGAGTAGGAGCGACCATGCATCATTCTGGCGTTCAAACCATTGGCCATGGAAAACGATTTTAAATGGCTTCTTAAGGCAACAGGGAGAGGAAGCTTGTCCACGAGGTGCACTGGGGTGCAGGATACAATGGCTCGGCAGCAGAGGTCTTGTAAACTCAGTACCTTGTTGGGCCTCCAAAGTCGGTCCATCCCATGTCTCATTAGAACTATCCGTGCCAGTTCAGTGAACGACTCCGTGATATTGAAGTTACACAGGGGGCTGACCTCGAAGAATGTCATGCCGAGCCGCTCAGCGAAGTTTTGTGCTTGGTCTGTTGACACCTGCCGTTTAAAGGCCAAATGAAGCCGGTTCCCCACCANGATTTTGGGCACCCCAGGAGCATGCTCATCTATCTCTTTAATCCACCGATCTATCCCGTCAAACGACCAGCGGTTTGTGATGTCATACACCAGAATTACACCCTGAACACCCCTCGAAAAGGAGCCAAATAATGGTGAAAAACTTCCCCTGCCCCAAGTTGTCCAAAAGCTGTAAATTTAATCCAAAAACCATTCCGGTAAAATTTGTGGTTTTTCTTGTTAATTCAATCCCCCCAAATTGTAAAACATTAAAAGGCGGACCCCTTTTGGGAATCCTTCCCGTGAAAGAGCGTTGTGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGATTTTGCAGCTGTTTCTGGT