ORFeome > rab7b ORF1 – XORFeome v1.0

rab7b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rab7b
Gene ID: 6079069
Gene Page ID: 5824212
ORF Xenbase ID: 17292261

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129677
Original XGC clone length: 606

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ837790
dbEST ID: 79655492
Trimmed Sequence: ATGAATTCTGGAAATAAAGTGGATCTTAAAATTAATATTATTGGCCCAATGGGAACTGGAAAAACTTCTCTTCTAAATCAGTATGTGCATAAGTGGTTCTTGAATGATTACCAGAACACATTGGGTGCCCATCTTCTGTCTAAAACCATCCAGTTGGACAACACAAACTTGAACTTGCAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTTTACNAAGGCTCTGATGGTTGTCTGCTAGTATTTGATGTCACTGACCAAAAGAGTTTTGCTTGTCTTGAATTCTGGAAAAAGGACTTTTTGGACAAAATACCTCCTCCTGCAGCTGATTTTCCTTTGATTGTTCTTGGAAATAAGATTGACCTCCATGACAGACAGGTCTCCCAGGAATCGGCAATGACCTGGTGCATAGGAAAAAAGGTTTCGTATTTAGAAGTCAGTGCCAAAAACAATGTCCACGTGAAAATTGCATTCGAAATACTTTGCCAGGAAAGCCCTTAAACACTTACCAAGAGGATAAAAGAAAGCTGCCCTAGGAAAGTCCAATAAAGCTGGGATGCCACAGAAGGATTCTCACAGTCATCCCATGCCTGCTTGCCCACTTTCCTTGGACAAATTTGGCATTTAAAAGAGAGCCATTGCTTATCAGTTTAGTTCCAACCAAACGGGGTCACTAGCGAGTTAAAAAAAAAACCGTTATTTGGCCCTCCCGGCTTAATATGCCCCCTAGGGTTGAGTTGGTAAAAAAAAAAAAAAAATAAGAAATTTTCCTTGGCGATCTCTCTGGCCCCCGGGTTCCCCAAAAATTCTCTGTTAAGTTTTAAA
Full Trace Sequence: CTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATTCTGGAAATAAAGTGGATCTTAAAATTAATATTATTGGCCCAATGGGAACTGGAAAAACTTCTCTTCTAAATCAGTATGTGCATAAGTGGTTCTTGAATGATTACCAGAACACATTGGGTGCCCATCTTCTGTCTAAAACCATCCAGTTGGACAACACAAACTTGAACTTGCAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTTTACNAAGGCTCTGATGGTTGTCTGCTAGTATTTGATGTCACTGACCAAAAGAGTTTTGCTTGTCTTGAATTCTGGAAAAAGGACTTTTTGGACAAAATACCTCCTCCTGCAGCTGATTTTCCTTTGATTGTTCTTGGAAATAAGATTGACCTCCATGACAGACAGGTCTCCCAGGAATCGGCAATGACCTGGTGCATAGGAAAAAAGGTTTCGTATTTAGAAGTCAGTGCCAAAAACAATGTCCACGTGAAAATTGCATTCGAAATACTTTGCCAGGAAAGCCCTTAAACACTTACCAAGAGGATAAAAGAAAGCTGCCCTAGGAAAGTCCAATAAAGCTGGGATGCCACAGAAGGATTCTCACAGTCATCCCATGCCTGCTTGCCCACTTTCCTTGGACAAATTTGGCATTTAAAAGAGAGCCATTGCTTATCAGTTTAGTTCCAACCAAACGGGGTCACTAGCGAGTTAAAAAAAAAACCGTTATTTGGCCCTCCCGGCTTAATATGCCCCCTAGGGTTGAGTTGGTAAAAAAAAAAAAAAAATAAGAAATTTTCCTTGGCGATCTCTCTGGCCCCCGGGTTCCCCAAAAATTCTCTGTTAAGTTTTAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTCTGGAAATAAAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837789
dbEST ID: 79655491
Trimmed Sequence: GCAGCATGTGTTACTGTGAGAATCCTCTGTGGCATCCAGCTTTATGGACTCTCCTAGGCAGCTTTCTTTATTCTCTTGGTAGTGTATTAAGGCTTTCTTGGCAAGTATTTCGAATGCAAGTTCCACGTTGACATTGTTTTTGGCACTGACTTCTAAATACGAAACCTTTTTTCCTTTGCACCAGGTCATTGCCGATTCCTTGGAGACCTGTCTGTCATTGAGGTCAATCTTATTTCCAAGAACAATCAAAGGAAAATCAGCTGCAGGAGGAGGTATTTTGTCCAAAAAGTCCTTTCTCCAGAATTCAAGACAAGCAAAACTCTCTTCGTCAGTGACATCAAATACTAGCAGACAACCATCATAGCCTTTGTAAAAAGTGGAAACCAAAGTCCGAAATCGTTCCTGTCCACCTGTATCCCAGATCTGCAAGTTCAAGTTTGTGTTGTCCAACTGGATGGTTTTAGACAGAAGATGGGCACCCAATGTGTTCTGGTAATCATTCAAGAACCACTTATGCACATACTGATTTAGAAGAGAAGTTTTTCCAGTTCCCATTGGGCCGATAATATTAATTTTAAGATCCACTTTATTTCCAGAATTCATGG
Full Trace Sequence: CTGCCGGGGAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAGCATGTGTTACTGTGAGAATCCTCTGTGGCATCCAGCTTTATGGACTCTCCTAGGCAGCTTTCTTTATTCTCTTGGTAGTGTATTAAGGCTTTCTTGGCAAGTATTTCGAATGCAAGTTCCACGTTGACATTGTTTTTGGCACTGACTTCTAAATACGAAACCTTTTTTCCTTTGCACCAGGTCATTGCCGATTCCTTGGAGACCTGTCTGTCATTGAGGTCAATCTTATTTCCAAGAACAATCAAAGGAAAATCAGCTGCAGGAGGAGGTATTTTGTCCAAAAAGTCCTTTCTCCAGAATTCAAGACAAGCAAAACTCTCTTCGTCAGTGACATCAAATACTAGCAGACAACCATCATAGCCTTTGTAAAAAGTGGAAACCAAAGTCCGAAATCGTTCCTGTCCACCTGTATCCCAGATCTGCAAGTTCAAGTTTGTGTTGTCCAACTGGATGGTTTTAGACAGAAGATGGGCACCCAATGTGTTCTGGTAATCATTCAAGAACCACTTATGCACATACTGATTTAGAAGAGAAGTTTTTCCAGTTCCCATTGGGCCGATAATATTAATTTTAAGATCCACTTTATTTCCAGAATTCATGGTGCCAGCTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCAGCGATTTTTTGCAACGAACAGGTCACTATCAGTCAAAATAGGATCATTATTTGGAAAAAAAAAATAAGGAAGAACGTCGTTCTCAACTCAGGTGACGGGGGGGGGAAGAAAACCCCAAGGTCCTTGAAACAAAGGTCCCTCGTGTAAACAACGAGGGAAGGGGAAAAACAGCCAGACCAAGGAAAACACCCGGGGGGGTTTTTGATGTNGAGGAAAAAAAGAAAAGAAAAAACCAAAGGGNCAAAAAAGAAGAGAAAAGGGGGGGGGGGAGGGGGGGGGGGGGGNGNTNGGNGNNNNNGAAAAAAGGGAGGNNNNGGNGNNGNNNNGGAAGGAGGGGGTATGGGANAAGAGGGGTANGNGGGGAAGGGAANAGGAGGNANGNNGGGGGNNGGAGGAANNNNNGNGGNGNNGGGNGGGGGGNGGGNNNNGAGGGNGGNGGGGNAAGGAANGGNNNNAANGNGGGNGAGNNGGNGGAAGGGGGGAGAGCGGNNGGGGGNNGGNAGNNGGGGGNGGNGNNGGGNNNGAAGGGAGAGAGGGGGANGGGGGGAGNNGAGGNG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGCATGTGTTACTGTGA