ORFeome > rabac1 ORF1 – XORFeome v1.0

rabac1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rabac1
Gene ID: 6255600
Gene Page ID: 959356
ORF Xenbase ID: 17292291

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082682
Original XGC clone length: 564

Human orthology & disease relationships

NCBI Entrez ID: 10567
Ensembl gene IDs: ENSG00000105404
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 248900,608611

Library Location

Plate ID: GDExl11004
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ839608
dbEST ID: 79657310
Trimmed Sequence: ATGGCGGGGAAGAACGGGGACGATTTTAGTGATGTAGCAGAAGAGGGACCAGGTGGAATCCTTAACAAAATGTTTCCTAAAATGATCACTCAGACTGCTGCGAAGGACTGGATTAACAGACGTCGTGCGCATATCCGCCCGTGGAGGAATTTTGTGGATCAGCGGCGTTTCTCTCGCCCTCCCAACTTCGGAGAACTGTGCAAGCGTATGACAAGGAATGTTGAGCATTTTCAAAGCAACTATATATTTATCTTCCTTGGACTCATCTTGTACTGCATAATCACCTCTCCGATGTTGCTGATCGCTTTAGCTGTGTTTTTTGGAGGTTGTTACATTATTTACCTGAGGACTCTGGAGTCGAAGATGGTTTTGTTTGGACGAGAGCTTAGCACAGCAAATCAGTATGGCTTGGCGGGTGCTGTGTCATTCCCCTTTTTCTGGCTTGCAGGAGCAGGTGCTGCTGTCTTCTGGGTTATTGGTGCCACACTTGTTGTGATTGGGTCCCACGCATCTTTTCATGAGATTGAGGGAGAGGTTGAAGAATTGCAGATGGAACCCGTGTT
Full Trace Sequence: TCCGCGGCACCAATAATTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGAAGAACGGGGACGATTTTAGTGATGTAGCAGAAGAGGGACCAGGTGGAATCCTTAACAAAATGTTTCCTAAAATGATCACTCAGACTGCTGCGAAGGACTGGATTAACAGACGTCGTGCGCATATCCGCCCGTGGAGGAATTTTGTGGATCAGCGGCGTTTCTCTCGCCCTCCCAACTTCGGAGAACTGTGCAAGCGTATGACAAGGAATGTTGAGCATTTTCAAAGCAACTATATATTTATCTTCCTTGGACTCATCTTGTACTGCATAATCACCTCTCCGATGTTGCTGATCGCTTTAGCTGTGTTTTTTGGAGGTTGTTACATTATTTACCTGAGGACTCTGGAGTCGAAGATGGTTTTGTTTGGACGAGAGCTTAGCACAGCAAATCAGTATGGCTTGGCGGGTGCTGTGTCATTCCCCTTTTTCTGGCTTGCAGGAGCAGGTGCTGCTGTCTTCTGGGTTATTGGTGCCACACTTGTTGTGATTGGGTCCCACGCATCTTTTCATGAGATTGAGGGAGAGGTTGAAGAATTGCAGATGGAACCCGTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGCATCCAGCTGATATCCCCTATAGTGAGTCGTAATACATGGTCAAAGCTGTTTCCTGACAGCTCCTGGCCGTGTCTCAATATCCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGAAGAACGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839607
dbEST ID: 79657309
Trimmed Sequence: CACGGGTTCCATCTGCAATTCTTCAACCTCTCCCTCAATCTCATGAAAAGATGCGTGGGACCCAATCACAACAAGTGTGGCACCAATAACCCAGAAGACAGCAGCACCTGCTCCTGCAAGCCAGAAAAAGGGGAATGACACAGCACCCGCCAAGCCATACTGATTTGCTGTGCTAAGCTCTCGTCCAAACAAAACCATCTTCGACTCCAGAGTCCTCAGGTAAATAATGTAACAACCTCCAAAAAACACAGCTAAAGCGATCAGCAACATCGGAGAGGTGATTATGCAGTACAAGATGAGTCCAAGGAAGATAAATATATAGTTGCTTTGAAAATGCTCAACATTCCTTGTCATACGCTTGCACAGTTCTCCGAAGTTGGGAGGGCGAGAGAAACGCCGCTGATCCACAAAATTCCTCCACGGGCGGATATGCGCACGACGTCTGTTAATCCAGTCCTTCGCAGCAGTCTGAGTGATCATTTTAGGAAACATTTTGTTAAGGATTCCACCTGGTCCCTCTTCTGCTACATCACTNAAATCGTCCCCGTTCTTCCCCGCCATGG
Full Trace Sequence: GAATAAGTCTATGGACCATGTAATACGACTCACTATAGGGGGAAATCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACGGGTTCCATCTGCAATTCTTCAACCTCTCCCTCAATCTCATGAAAAGATGCGTGGGACCCAATCACAACAAGTGTGGCACCAATAACCCAGAAGACAGCAGCACCTGCTCCTGCAAGCCAGAAAAAGGGGAATGACACAGCACCCGCCAAGCCATACTGATTTGCTGTGCTAAGCTCTCGTCCAAACAAAACCATCTTCGACTCCAGAGTCCTCAGGTAAATAATGTAACAACCTCCAAAAAACACAGCTAAAGCGATCAGCAACATCGGAGAGGTGATTATGCAGTACAAGATGAGTCCAAGGAAGATAAATATATAGTTGCTTTGAAAATGCTCAACATTCCTTGTCATACGCTTGCACAGTTCTCCGAAGTTGGGAGGGCGAGAGAAACGCCGCTGATCCACAAAATTCCTCCACGGGCGGATATGCGCACGACGTCTGTTAATCCAGTCCTTCGCAGCAGTCTGAGTGATCATTTTAGGAAACATTTTGTTAAGGATTCCACCTGGTCCCTCTTCTGCTACATCACTNAAATCGTCCCCGTTCTTCCCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCATTTTGTTGCAACGAACAGGTCACTAATCATTCAAAAATAAAATCATTTATTTTGAAAGCCCGACCTTTATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACGGGTTCCATCTGCAATTCT