ORFeome > rad9a ORF1 – XORFeome v1.0

rad9a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rad9a
Gene ID: 975078
Gene Page ID: 975072
ORF Xenbase ID: 17292417

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084872
Original XGC clone length: 1134

Human orthology & disease relationships

NCBI Entrez ID: 5883
Ensembl gene IDs: ENSG00000172613
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,124200,228600,236490,300291,300301,300584,308300,600072,603218

Library Location

Plate ID: GDExl11005
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ839959
dbEST ID: 79657661
Trimmed Sequence: ATGGGAGGAGAAGTAAAGTGTGTGATTACTGGAACCAACATTAAAGCACTTGGGCGAGCTGTACATTCCCTTTCACGAATAGGAGATGAATTATATTTTGAGCCTTTGGAAGATGGACTTTGTCTGCGCTCTGTCAATTCATCTCGATCAGCCTATGCCTGTTTTACACTAGCGCCCCTGTTTTTCCACAGTTATGAGGCAACAGGTGGAACCTGCCACTGCAAGATACACATGAAGTCAGTGATTAGTGTTTTTCGCTCCCTCCCATCTTTGGAGAAGACTGTAGAGAAATGTCTCATCAGCCTCAATACCACAAATAGTCGCCTAGTCATCCAGCTTCTATGCAAATATGGAATTACGAAAACACACAATTTGTCATATCAAGACTGTGAGTCTCTACAGGCTGTGTACAACCCCGATACCTGTCCTAATATACTGAGAGCTCCTGCAAGACTGCTCTCAGATGCTGTGATGCACTTCCCTCCGACTCTTGCAGAGATTACATTAATGGCAAGCCCTTGTGGAAAAGTTACCTTACGGAATTATGTTGAGGAGGATGTAGATGCGACTAAAGCCATGCTAACAGAGCTAGCCCTGAGTAGGGATGATTTCCTGGTGTACAATCTAAAGAAACAGAGCGACATAACCTTCTGTTTGCGTGAATTCCGGGGACTTCTGAGTTTTGCAGAATCACTAACCCTCCAGCCTCTATACATTTTCACAGTGCTTGGTTTTCCAGCTGTAATCAGTTTCGATTAATACATATACTTGAAATTGCAATTTT
Full Trace Sequence: GGGGCCCATATAATAGATTTTANTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAGGAGAAGTAAAGTGTGTGATTACTGGAACCAACATTAAAGCACTTGGGCGAGCTGTACATTCCCTTTCACGAATAGGAGATGAATTATATTTTGAGCCTTTGGAAGATGGACTTTGTCTGCGCTCTGTCAATTCATCTCGATCAGCCTATGCCTGTTTTACACTAGCGCCCCTGTTTTTCCACAGTTATGAGGCAACAGGTGGAACCTGCCACTGCAAGATACACATGAAGTCAGTGATTAGTGTTTTTCGCTCCCTCCCATCTTTGGAGAAGACTGTAGAGAAATGTCTCATCAGCCTCAATACCACAAATAGTCGCCTAGTCATCCAGCTTCTATGCAAATATGGAATTACGAAAACACACAATTTGTCATATCAAGACTGTGAGTCTCTACAGGCTGTGTACAACCCCGATACCTGTCCTAATATACTGAGAGCTCCTGCAAGACTGCTCTCAGATGCTGTGATGCACTTCCCTCCGACTCTTGCAGAGATTACATTAATGGCAAGCCCTTGTGGAAAAGTTACCTTACGGAATTATGTTGAGGAGGATGTAGATGCGACTAAAGCCATGCTAACAGAGCTAGCCCTGAGTAGGGATGATTTCCTGGTGTACAATCTAAAGAAACAGAGCGACATAACCTTCTGTTTGCGTGAATTCCGGGGACTTCTGAGTTTTGCAGAATCACTAACCCTCCAGCCTCTATACATTTTCACAGTGCTTGGTTTTCCAGCTGTAATCAGTTTCGATTAATACATATACTTGAAATTGCAATTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGGAGAAGTAAAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839958
dbEST ID: 79657660
Trimmed Sequence: TTCTTCTCCATCACTATCTTCAGCCAAAATCTCTTGATTTGAATGACCGGAGCTTGCCAGAATAGACCCAAAAAAAAGGGACCGAAACTTCTTGTTGGGAGGTGTCCCAGGGACTCCTGTTTCGAGTTCATCATCACTTGATAGACCCTGAGATTCTTGTAAAGGAATTATGCTAGAGCGATTGCAGAAGGTAGGACTAGTGGGTGGGGAAGGATTTGCAAGAGTGGTTTCCATTGCAATCATATAGTCTATATCATCACCTAAAAAGTCATCCTCTGTTGAAAGCAAGGGTCTGTTGTTCTGAGACTCTGTCTGTGATGCTCTGTCTGTGTCAGAAAGAGTAGCAAGAACAAAATGCACTTCAAGTACTGTATCATCGACACTGAATACAGCTGGACAACCAGCACTGTTGAAATGTATAGAGACTGGAAGGCTAGTCGATTCTGCAAAACTCAGAAGTCCCCGGAATTCACGCAAACAGAAGGTTATGTCGCTCTGTTTCTTTAGATTGTACACCAGGAATTCATCCCTACTCAGGGCTAGCTCTGTAACCAGGCTTTAGTCCCATCTACATCCTCCTCAACATAATTTCCTAAGGTAACTTTCCACAAGGGCTTGCCATTAATGTAATCTCCGCCAAAAATCGGAGGGAAATGGATCAGACCATCTTAAAACAATCCTGCCGGGACTCCTCAGTAATTTAAGGAAAGGTAACGGGGGTTATAG
Full Trace Sequence: AAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTTCTCCATCACTATCTTCAGCCAAAATCTCTTGATTTGAATGACCGGAGCTTGCCAGAATAGACCCAAAAAAAAGGGACCGAAACTTCTTGTTGGGAGGTGTCCCAGGGACTCCTGTTTCGAGTTCATCATCACTTGATAGACCCTGAGATTCTTGTAAAGGAATTATGCTAGAGCGATTGCAGAAGGTAGGACTAGTGGGTGGGGAAGGATTTGCAAGAGTGGTTTCCATTGCAATCATATAGTCTATATCATCACCTAAAAAGTCATCCTCTGTTGAAAGCAAGGGTCTGTTGTTCTGAGACTCTGTCTGTGATGCTCTGTCTGTGTCAGAAAGAGTAGCAAGAACAAAATGCACTTCAAGTACTGTATCATCGACACTGAATACAGCTGGACAACCAGCACTGTTGAAATGTATAGAGACTGGAAGGCTAGTCGATTCTGCAAAACTCAGAAGTCCCCGGAATTCACGCAAACAGAAGGTTATGTCGCTCTGTTTCTTTAGATTGTACACCAGGAATTCATCCCTACTCAGGGCTAGCTCTGTAACCAGGCTTTAGTCCCATCTACATCCTCCTCAACATAATTTCCTAAGGTAACTTTCCACAAGGGCTTGCCATTAATGTAATCTCCGCCAAAAATCGGAGGGAAATGGATCAGACCATCTTAAAACAATCCTGCCGGGACTCCTCAGTAATTTAAGGAAAGGTAACGGGGGTTATAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTTCTCCATCACTATCTTCAG