ORFeome > rae1 ORF1 – XORFeome v1.0

rae1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rae1
Gene ID: 995607
Gene Page ID: 995594
ORF Xenbase ID: 17292423

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133771
Original XGC clone length: 1107

Human orthology & disease relationships

NCBI Entrez ID: 8480
Ensembl gene IDs: ENSG00000101146
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 188550,231550,609192

Library Location

Plate ID: GDExl11089
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ838481
dbEST ID: 79656183
Trimmed Sequence: ATGAGTTTGTTTTCCACCCCTGGGGGATTTGGAACTGGGGGCGGCAGTATGTTCGGCAGCACAGCGACTGATAACCACAATCCTATGAAGGACATTGAAGTGGCATCACCTCCAGATGACAGCATCTCGTGCCTCTCTTTCAGCCCCCCAACCCTGCCGGGCAACTTCCTGATTGCAGGATCCTGGGCCAATGATGTGAGGTGCTGGGAAGTTCAAGATAATGGACAGACCATTCCAAAAGCACAACAGATGCACACAGGCCCTGTGCTTGACGTCTGCTGGAGTGATGACGGGACCAAAGTGTTTACAGCCTCATGTGATAAAACTGCCAAAATGTGGGATCTTAACAGCAACCAGTCAATACAAGTTGCACAGCATGAAGCCCCTATAAAGACTGTGCATTGGGTAAAGGCTCCAAATTATAGTTGCATCATGACTGGTGGCTGGGATAAAAGTTTAAAGTTTTGGGACACAAGATCACCAAACCCACTGCTGACCCTACAACTCCCAGAACGATGTTACTGTGCTGATGTGGTGTACCCTATGGCTGTTGTGGCCACTGCAGAGAGAGGGTTAATAGTGTATCAGCTTGAGAACCAACCGTCCGAATTCAGAAGAATAGACTCTCCCCTCCAACATCAACACCGCTGTGTCGCCCTGATTTAAAGACAAA
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTTTGTTTTCCACCCCTGGGGGATTTGGAACTGGGGGCGGCAGTATGTTCGGCAGCACAGCGACTGATAACCACAATCCTATGAAGGACATTGAAGTGGCATCACCTCCAGATGACAGCATCTCGTGCCTCTCTTTCAGCCCCCCAACCCTGCCGGGCAACTTCCTGATTGCAGGATCCTGGGCCAATGATGTGAGGTGCTGGGAAGTTCAAGATAATGGACAGACCATTCCAAAAGCACAACAGATGCACACAGGCCCTGTGCTTGACGTCTGCTGGAGTGATGACGGGACCAAAGTGTTTACAGCCTCATGTGATAAAACTGCCAAAATGTGGGATCTTAACAGCAACCAGTCAATACAAGTTGCACAGCATGAAGCCCCTATAAAGACTGTGCATTGGGTAAAGGCTCCAAATTATAGTTGCATCATGACTGGTGGCTGGGATAAAAGTTTAAAGTTTTGGGACACAAGATCACCAAACCCACTGCTGACCCTACAACTCCCAGAACGATGTTACTGTGCTGATGTGGTGTACCCTATGGCTGTTGTGGCCACTGCAGAGAGAGGGTTAATAGTGTATCAGCTTGAGAACCAACCGTCCGAATTCAGAAGAATAGACTCTCCCCTCCAACATCAACACCGCTGTGTCGCCCTGATTTAAAGACAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTTGTTTTCCACCCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838480
dbEST ID: 79656182
Trimmed Sequence: TTTCTTGTTCCGGGGTTTCAATTCTTCAGCGGCGTTACGCAAGAAGATATAGTTCTTCTTCTGTGGATTGTAGAATTCATGCCCCTTGGACCAGTCATAGCTAGAAGAATAGGCGAAAATATTTCCATTGTGGTTGAAAGAACAAGCAGAGATTGGCTGGTCCAGCTGCTCCGAAGTCTTCAGTTTGGTCCGGGCATCTTTGTCCCAGAAACTGAATCGTCCATCTGAGCCAACCGTAGCCAAAGTGCCGTGTACAGGATGGAAAGCGATGCCATTTACAGCATATATATCTTGAGGGGCTGTTGTGTTCGTGCCATTGGAGCGGTGGCATTTAAATGTGAAGTTGTCTTTGGCTGGATTGGGAGGGTTGATGTAATGAATTGCGACTCTTCCGTCTATACATCAAAGTGCAAAGCCCGTTGGCTTGTTCTGCTTGTCTTTAAATATGGCGACACAGCCGTGCTGATGTTTGAGGGGAGAGGGAGGGCTCTGAAATCCGACGGCTGAGGCGCGGGCTGAGGGGGTAGTAATCGATCGGTCTTCGGTGGCCGCGCCGGCCCATAAAGAAAAGGGAGGCAACCCCCTAAGAAGCTTTTCGGGGAGTGGGGGGGGGGGGGCGGGGGGGTGTAGGGGAGGGGGGGGGGGGGAAAGCGGTGAAGCGAGGGATTC
Full Trace Sequence: GGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTGTTCCGGGGTTTCAATTCTTCAGCGGCGTTACGCAAGAAGATATAGTTCTTCTTCTGTGGATTGTAGAATTCATGCCCCTTGGACCAGTCATAGCTAGAAGAATAGGCGAAAATATTTCCATTGTGGTTGAAAGAACAAGCAGAGATTGGCTGGTCCAGCTGCTCCGAAGTCTTCAGTTTGGTCCGGGCATCTTTGTCCCAGAAACTGAATCGTCCATCTGAGCCAACCGTAGCCAAAGTGCCGTGTACAGGATGGAAAGCGATGCCATTTACAGCATATATATCTTGAGGGGCTGTTGTGTTCGTGCCATTGGAGCGGTGGCATTTAAATGTGAAGTTGTCTTTGGCTGGATTGGGAGGGTTGATGTAATGAATTGCGACTCTTCCGTCTATACATCAAAGTGCAAAGCCCGTTGGCTTGTTCTGCTTGTCTTTAAATATGGCGACACAGCCGTGCTGATGTTTGAGGGGAGAGGGAGGGCTCTGAAATCCGACGGCTGAGGCGCGGGCTGAGGGGGTAGTAATCGATCGGTCTTCGGTGGCCGCGCCGGCCCATAAAGAAAAGGGAGGCAACCCCCTAAGAAGCTTTTCGGGGAGTGGGGGGGGGGGGGCGGGGGGGTGTAGGGGAGGGGGGGGGGGGGAAAGCGGTGAAGCGAGGGATTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTGTTCCGGGGTTTC