ORFeome > rag2 ORF1 – XORFeome v1.0

rag2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rag2
Gene ID: 1018151
Gene Page ID: 1018148
ORF Xenbase ID: 17292435

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129719
Original XGC clone length: 1563

Human orthology & disease relationships

NCBI Entrez ID: 5897
Ensembl gene IDs: ENSG00000175097,LRG_99
Directly associated (OMIM) disease MIM numbers: 233650,601457,603554
Indirectly associated (Lage, et al.) disease MIM numbers: 601457,603554

Library Location

Plate ID: GDExl11092
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ838964
dbEST ID: 79656666
Trimmed Sequence: ATGACCCTCCGGATAGTAACGCCTGGGAGTAACACATCACTGATCCAGCCTGGGTTCTCTTTGCTTCATTTTAGCAGCCATGTCTTTTACTTAGGACAGAAAGGCTGGCCTAAACGTTCCTGCCCCACTGGGGTTTTCCTGTTGGATCTCAAAAACAATGATTTAAAGCTCCGGCCCGCCACATTTACCAATGACTCCTGCTATCTCCCTCCACTTAGGCATCCAGCTGTGTGCAGCTTCTCAGCCAGTCAAGGTGGGGAGATCACACAATACCTCATACATGGAGGAAAGACCCCAAATAATGAGATCTCTCATAAACTATACATTATGACCATGGCATTTCCAGTCAATAAGAGATTTTCACTCTGTTGCTCAGAAAAGGATCTAGCAGGAGACGTCCCTGAAGCTAGGTATGGTCATTCTATGAATGTAGTTTTTAGCAGGGGCAAGAATGCGGTTGTGATGTTCGGTGGAAGGTCCTATATGCCGTTAAATCAAAGAACCACTGAAAACTGGAACAACGTCATTGATTGTGAACCATTGGTTTACCTTATTGATCTCCAATTTGGGTGTTCTACCAGCTTTAACCTTCGAGAGCTTCAGGATGGACTTTCCTTCCATGTTTCTTTACCAAGAAATGATACAGTCTACATTTTTTGGGGTCATTCGTTGGGGAACGATTGTAAGACCTCCCAATGTCTACGAGAAGAAATTGGATCTGCCGCCTGGAAACCCGGGCGGAACCTGGCCCAGTCCTAAACCGCAAAAAATTCTTTCTCTTACCTCCCTTATCACCTCCAAACACACCCCCCCAAAAAA
Full Trace Sequence: CGAGGGCCCACATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCCTCCGGATAGTAACGCCTGGGAGTAACACATCACTGATCCAGCCTGGGTTCTCTTTGCTTCATTTTAGCAGCCATGTCTTTTACTTAGGACAGAAAGGCTGGCCTAAACGTTCCTGCCCCACTGGGGTTTTCCTGTTGGATCTCAAAAACAATGATTTAAAGCTCCGGCCCGCCACATTTACCAATGACTCCTGCTATCTCCCTCCACTTAGGCATCCAGCTGTGTGCAGCTTCTCAGCCAGTCAAGGTGGGGAGATCACACAATACCTCATACATGGAGGAAAGACCCCAAATAATGAGATCTCTCATAAACTATACATTATGACCATGGCATTTCCAGTCAATAAGAGATTTTCACTCTGTTGCTCAGAAAAGGATCTAGCAGGAGACGTCCCTGAAGCTAGGTATGGTCATTCTATGAATGTAGTTTTTAGCAGGGGCAAGAATGCGGTTGTGATGTTCGGTGGAAGGTCCTATATGCCGTTAAATCAAAGAACCACTGAAAACTGGAACAACGTCATTGATTGTGAACCATTGGTTTACCTTATTGATCTCCAATTTGGGTGTTCTACCAGCTTTAACCTTCGAGAGCTTCAGGATGGACTTTCCTTCCATGTTTCTTTACCAAGAAATGATACAGTCTACATTTTTTGGGGTCATTCGTTGGGGAACGATTGTAAGACCTCCCAATGTCTACGAGAAGAAATTGGATCTGCCGCCTGGAAACCCGGGCGGAACCTGGCCCAGTCCTAAACCGCAAAAAATTCTTTCTCTTACCTCCCTTATCACCTCCAAACACACCCCCCCAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCCTCCGGATAGTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838963
dbEST ID: 79656665
Trimmed Sequence: CTCAAACAGACGCCTGAGGAAAGATTTCTTGACTGCTGAAAGTCTATTGATTGTTGTTCTTTTGCGAACGGATTTCAATGAAGTCTTTTTTACAGGCGGGGTCTTCTCTGGTGTTTGCACCCCCCTCGCTACCTCAACATGTTCATTGCAGAAGTACTTGATGTTGTTTTGAGACAGGTATTTGAGCATGGTCTCTGATAGATCCATGCACTGCGAATGCACCCAGTGGCCGCCATCTTTGGAGCAGAAGATCATGGATGGCTTGTTGAGCTCCGTGGAATAGAAAGGCTCCCAGGTGTTTCTATCCATATCACAGTCAGGGCAACACTTGATCCAGTATCCAGTTACTGATTCATCGTCTTCATCGTCTTCATTGTAAGTATCCTCGTCAAAAATGTTCCCGTCTCTGTTGAATGTAAATTCTTCAGAGTCTTCGAGAGGCATGGAATCTTCTTGTTCCTCCGTCGATCCCTGGCTACACGTCTGCAGCGCTGGATCATTATCTCCAAAATTTAGTACGTAAAAGAAAAAACTGCAGTCCGTGCTTTGATGCTTATTGTCTACTGGGATGCCAAATAAAACTGCCCCTTTTCCCATATCAGCACCAAACAANGTCTTGCTGTGTTTAATTTCCCCGGTCCAATCGGGGGTCTCTATTTCTTGAATGGCAATGGTTTCATTATCCAAAAAAACTCCCTTTGCAAATAATTCTTTTCCTGCCTAACAAACTCCGAATTCCCCCCCCAATGACCAACCCCCACC
Full Trace Sequence: GGGGAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCAAACAGACGCCTGAGGAAAGATTTCTTGACTGCTGAAAGTCTATTGATTGTTGTTCTTTTGCGAACGGATTTCAATGAAGTCTTTTTTACAGGCGGGGTCTTCTCTGGTGTTTGCACCCCCCTCGCTACCTCAACATGTTCATTGCAGAAGTACTTGATGTTGTTTTGAGACAGGTATTTGAGCATGGTCTCTGATAGATCCATGCACTGCGAATGCACCCAGTGGCCGCCATCTTTGGAGCAGAAGATCATGGATGGCTTGTTGAGCTCCGTGGAATAGAAAGGCTCCCAGGTGTTTCTATCCATATCACAGTCAGGGCAACACTTGATCCAGTATCCAGTTACTGATTCATCGTCTTCATCGTCTTCATTGTAAGTATCCTCGTCAAAAATGTTCCCGTCTCTGTTGAATGTAAATTCTTCAGAGTCTTCGAGAGGCATGGAATCTTCTTGTTCCTCCGTCGATCCCTGGCTACACGTCTGCAGCGCTGGATCATTATCTCCAAAATTTAGTACGTAAAAGAAAAAACTGCAGTCCGTGCTTTGATGCTTATTGTCTACTGGGATGCCAAATAAAACTGCCCCTTTTCCCATATCAGCACCAAACAANGTCTTGCTGTGTTTAATTTCCCCGGTCCAATCGGGGGTCTCTATTTCTTGAATGGCAATGGTTTCATTATCCAAAAAAACTCCCTTTGCAAATAATTCTTTTCCTGCCTAACAAACTCCGAATTCCCCCCCCAATGACCAACCCCCACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAAACAGACGCCTGAGGAA