ORFeome > ralb ORF2 – XORFeome v1.0

ralb ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ralb
Gene ID: 6254042
Gene Page ID: 494547
ORF Xenbase ID: 17292453

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108805
Original XGC clone length: 621

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ837729
dbEST ID: 79655431
Trimmed Sequence: ATGGCTGCTAACAAGAATAAGAACCAGAGCTCCCTGGTGCTGCACAAAGTGATAATGGTGGGCAGTGGTGGTGTTGGCAAGTCGGCTCTCACCCTGCAGTTCATGTATGACGAGTTTGTAGAGGACTATGAACCCACCAAAGCCGACAGCTACAGGAAGAAAGTGGTTCTAGATGGGGAGGAGGTACAGATTGATATACTGGACACTGCCGGACAGGAGGACTATGCAGCCATTCGTGATAACTACTTCCGCAGTGGGGAGGGCTTCCTTCTTGTCTTTTCCATTACTGAGCATGAGTCTTTCACAGCCACAGCTGAGTTCAGGGAACAAATCCTGCGAGTCAAAGCGGAAGAAGATAAAATCCCCTTGCTCATAGTGGGCAACAAGTCTGATCTGGAAGACAGGAGACAGGTCCCTATGGATGAAGCCAGAGGCAAAGCAGAAGAGTGGGGGGTACAGTATGTGGAGACATCTGCCAAAACCACAACAAATGTGGACAAAGTATTTTTTGACCTAATGAGGGAAATCCGAACAAAGAAAATGTCTGAGAAACAAGATAAGAATGGAAAGAAGAACCCCAAGACCAAGAAGGCCTTCGTGCAACGCCTGCTGTTTACTCTTGCCCACCTTCCTGGTGCAGGGTGGGGGTTATGAGGAAGGCATTGCTTAATAAT
Full Trace Sequence: GGCGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTAACAAGAATAAGAACCAGAGCTCCCTGGTGCTGCACAAAGTGATAATGGTGGGCAGTGGTGGTGTTGGCAAGTCGGCTCTCACCCTGCAGTTCATGTATGACGAGTTTGTAGAGGACTATGAACCCACCAAAGCCGACAGCTACAGGAAGAAAGTGGTTCTAGATGGGGAGGAGGTACAGATTGATATACTGGACACTGCCGGACAGGAGGACTATGCAGCCATTCGTGATAACTACTTCCGCAGTGGGGAGGGCTTCCTTCTTGTCTTTTCCATTACTGAGCATGAGTCTTTCACAGCCACAGCTGAGTTCAGGGAACAAATCCTGCGAGTCAAAGCGGAAGAAGATAAAATCCCCTTGCTCATAGTGGGCAACAAGTCTGATCTGGAAGACAGGAGACAGGTCCCTATGGATGAAGCCAGAGGCAAAGCAGAAGAGTGGGGGGTACAGTATGTGGAGACATCTGCCAAAACCACAACAAATGTGGACAAAGTATTTTTTGACCTAATGAGGGAAATCCGAACAAAGAAAATGTCTGAGAAACAAGATAAGAATGGAAAGAAGAACCCCAAGACCAAGAAGGCCTTCGTGCAACGCCTGCTGTTTACTCTTGCCCACCTTCCTGGTGCAGGGTGGGGGTTATGAGGAAGGCATTGCTTAATAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTAACAAGAATAAGAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837728
dbEST ID: 79655430
Trimmed Sequence: GAGTAAACAGCAGCGTTGTTTGAAGCCCTTCTTGCTCTTCCCGCTCTTCTTCCCATTCTTATCCTTGTTCTCAGACATTTTCTTCGTTCGGATTTCCCTCATTAGGTCAAAAAATACTTTGTCCACATTTGCTCTGGTTTTCGCAGATGTCTCCACATACTGTACCCCCCACTCTTCTGCTTTGCCTCTGGCTTCATCCATAGGGACCTGTCTCCTGTCTTCCAGATCAGACTTGTTGCCCACTATGAGCAAGGGGATTTTATCTTCTTCCGCTTTGACTCGCAGGATTTGTTCCCTGAACTCAGCTGTGGCTGTGAAAGACTCATGCTCAGTAATGGAAAAGACAAGAAGGAAGCCCTCCCCACTGCGGAAGTAGTTATCACGAATGGCTGCATAGTCCTCCTGTCCGGCAGTGTCCAGTATATCAATCTGTACCTCCTCCCCATCTAGAACCACTTTCTTCCTGTAGCTGTCGGCTTTGGTGGGTTCATAGTCCTCTACAAACTCGTCATACATGAAGTGCAGGGTGAGAGCCGACTTGCCAACACCACCACTGCCCACCAGTATCACTTTGTGGAGCAGGCGGGAGCTCGGGTTCTTATTCTTGTTAGGGACCCTGGTGCCGACTTTTTTGTACGGGTTTGGCCATATAAAAAAAGATTGCTCATGGTTTTGTTGCACCGAGGGGGTACGAATGGGTCGGGTTAAATCAAAAAGAGAAAAAAAGAGAAAAACAGACCGTCGTCTCCCAAAACCGCACGGAAAAAATCCCCGAATGGCTCGCCCCAAGATGGGGGTGGTGTTATCTGGGAAGGGGGGGAGGCGCGGCGGCGGGGGGGAAAACGGTTGGGGGTGAAAAAAGTGAGGGAGAGGGGGGGGGCCCCCCGCCGTGGGCCAAAACCTTAGCGGGAAAAAGGAAGAAAAAAAAAAAGGAAGAAAAAAAAACAAAAAATGGGCGTTTTTCTGGGGAAAACAAAA
Full Trace Sequence: CGGGCAGGTAACAGCTTATGAACATGTAATACGACTCACTATTAGGGGAAACCAGCTGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGTAAACAGCAGCGTTGTTTGAAGCCCTTCTTGCTCTTCCCGCTCTTCTTCCCATTCTTATCCTTGTTCTCAGACATTTTCTTCGTTCGGATTTCCCTCATTAGGTCAAAAAATACTTTGTCCACATTTGCTCTGGTTTTCGCAGATGTCTCCACATACTGTACCCCCCACTCTTCTGCTTTGCCTCTGGCTTCATCCATAGGGACCTGTCTCCTGTCTTCCAGATCAGACTTGTTGCCCACTATGAGCAAGGGGATTTTATCTTCTTCCGCTTTGACTCGCAGGATTTGTTCCCTGAACTCAGCTGTGGCTGTGAAAGACTCATGCTCAGTAATGGAAAAGACAAGAAGGAAGCCCTCCCCACTGCGGAAGTAGTTATCACGAATGGCTGCATAGTCCTCCTGTCCGGCAGTGTCCAGTATATCAATCTGTACCTCCTCCCCATCTAGAACCACTTTCTTCCTGTAGCTGTCGGCTTTGGTGGGTTCATAGTCCTCTACAAACTCGTCATACATGAAGTGCAGGGTGAGAGCCGACTTGCCAACACCACCACTGCCCACCAGTATCACTTTGTGGAGCAGGCGGGAGCTCGGGTTCTTATTCTTGTTAGGGACCCTGGTGCCGACTTTTTTGTACGGGTTTGGCCATATAAAAAAAGATTGCTCATGGTTTTGTTGCACCGAGGGGGTACGAATGGGTCGGGTTAAATCAAAAAGAGAAAAAAAGAGAAAAACAGACCGTCGTCTCCCAAAACCGCACGGAAAAAATCCCCGAATGGCTCGCCCCAAGATGGGGGTGGTGTTATCTGGGAAGGGGGGGAGGCGCGGCGGCGGGGGGGAAAACGGTTGGGGGTGAAAAAAGTGAGGGAGAGGGGGGGGGCCCCCCGCCGTGGGCCAAAACCTTAGCGGGAAAAAGGAAGAAAAAAAAAAAGGAAGAAAAAAAAACAAAAAATGGGCGTTTTTCTGGGGAAAACAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGTAAACAGCAGCGTTGTTTGA