ORFeome > ranbp1 ORF1 – XORFeome v1.0

ranbp1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ranbp1
Gene ID: 866013
Gene Page ID: 490909
ORF Xenbase ID: 17292465

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054182
Original XGC clone length: 630

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ839060
dbEST ID: 79656762
Trimmed Sequence: ATGGCCGATACCAAGGATAAACCAGAAGAGCGTGACACCTCTGTTGACAATACAGAAGATTCAAATCATGACCCTCATTTTGAGCCCATAGTTTCACTGCCAGAGCAAGAGATTAAGACACTTGAAGAAGATGAAGAAGAACTATTTAAAATGCGTGCAAAGTTGTTTCGATTTGCATCAGAAAATGACCCACCGGAATGGAAAGAACGGGGCACAGGCGATGTTAAATTGCTGAAACACAAAGAGAAGGGAACAATTCGTCTCTTGATGAGGAGAGACAAGACACTGAAGATATGTGCAAATCATGCTATTACCCCTGTGATGGAACTGAAGCCTAATGCGGGAAGTGACCGGGCATGGGTTTGGAACACATATGCTGATTATGCAGATGAATTGCCAAAACCTGAACTACTGGCTATTCGATTTTTAAATGCAGAAAATGCACAGAAGTTCAAGGCAAAATTTGAAGAATGCAGAAATGAAGTGAAGAGTAATAAAGAAAAAGATACAACCAAAAATGATAGTGCCGACNAAGTGGCAGAGAAACTAGAAGAGCTGTCTGTAAAGGAGGCAAAAGTGCAAGACAAGCAAGAAGACCCCAAGCAGGATAAAGCAGAGGAAAAGCAATT
Full Trace Sequence: CCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGATACCAAGGATAAACCAGAAGAGCGTGACACCTCTGTTGACAATACAGAAGATTCAAATCATGACCCTCATTTTGAGCCCATAGTTTCACTGCCAGAGCAAGAGATTAAGACACTTGAAGAAGATGAAGAAGAACTATTTAAAATGCGTGCAAAGTTGTTTCGATTTGCATCAGAAAATGACCCACCGGAATGGAAAGAACGGGGCACAGGCGATGTTAAATTGCTGAAACACAAAGAGAAGGGAACAATTCGTCTCTTGATGAGGAGAGACAAGACACTGAAGATATGTGCAAATCATGCTATTACCCCTGTGATGGAACTGAAGCCTAATGCGGGAAGTGACCGGGCATGGGTTTGGAACACATATGCTGATTATGCAGATGAATTGCCAAAACCTGAACTACTGGCTATTCGATTTTTAAATGCAGAAAATGCACAGAAGTTCAAGGCAAAATTTGAAGAATGCAGAAATGAAGTGAAGAGTAATAAAGAAAAAGATACAACCAAAAATGATAGTGCCGACNAAGTGGCAGAGAAACTAGAAGAGCTGTCTGTAAAGGAGGCAAAAGTGCAAGACAAGCAAGAAGACCCCAAGCAGGATAAAGCAGAGGAAAAGCAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGGCACGAACAGGTCACTATCAGTCAAAATTAAATTCATTATTTGCCCTCCAGCTGAATATCCCCAATAGTGAATCGTAATTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGATACCAAGGATAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839059
dbEST ID: 79656761
Trimmed Sequence: TTGCTTTTCCTCTGCTTTATCCTGCTTGGGGTCTTCTTGCTTGTCTTGCACTTTTGCCTCCTTTACAGACAGCTCTTCTAGTTTCTCTGCCACTTTGTCGGCACTATCATTTTTGGTTGTATCTTTTTCTTTATTACTCTTCACTTCATTTCTGCATTCTTCAAATTTTGCCTTGAACTTCTGTGCATTTTCTGCATTTAAAAATCGAATAGCCAGTAGTTCAGGTTTTGGCAATTCATCTGCATAATCAGCATATGTGTTCCAAACCCATGCCCGGTCACTTCCCGCATTAGGCTTCAGTTCCATCACAGGGGTAATAGCATGATTTGCACATATCTTCAGTGTCTTGTCTCTCCTCATCAAGAGACGAATTGTTCCCTTCTCTTTGTGTTTCAGCAATTTAACATCGCCTGTGCCCCGTTCTTTCCATTCCGGTGGGTCATTTTCTGATGCAAATCGAAACAACTTTGCACGCATTTTAAATAGTTCTTCTTCATCTTCTTCAAGTGTCTTAATCTCTTGCTCTGGCAGTGAAACTATGGGGCTTAAAATGAGGGTCATGATTTGAAACCTTCTGTATTGTTCACAGAAGGTGTCACGCTTCTTTTGGTTTATTCCTGGTATCGGCCCATGGTGCCAAACTTTTTTTTGTACAAATTTTGGAATTATAAAAAAAAACCATTGGTTCAATCATTTTGTTTTCAACGA
Full Trace Sequence: CGAGAAAAAGTCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGCTTTTCCTCTGCTTTATCCTGCTTGGGGTCTTCTTGCTTGTCTTGCACTTTTGCCTCCTTTACAGACAGCTCTTCTAGTTTCTCTGCCACTTTGTCGGCACTATCATTTTTGGTTGTATCTTTTTCTTTATTACTCTTCACTTCATTTCTGCATTCTTCAAATTTTGCCTTGAACTTCTGTGCATTTTCTGCATTTAAAAATCGAATAGCCAGTAGTTCAGGTTTTGGCAATTCATCTGCATAATCAGCATATGTGTTCCAAACCCATGCCCGGTCACTTCCCGCATTAGGCTTCAGTTCCATCACAGGGGTAATAGCATGATTTGCACATATCTTCAGTGTCTTGTCTCTCCTCATCAAGAGACGAATTGTTCCCTTCTCTTTGTGTTTCAGCAATTTAACATCGCCTGTGCCCCGTTCTTTCCATTCCGGTGGGTCATTTTCTGATGCAAATCGAAACAACTTTGCACGCATTTTAAATAGTTCTTCTTCATCTTCTTCAAGTGTCTTAATCTCTTGCTCTGGCAGTGAAACTATGGGGCTTAAAATGAGGGTCATGATTTGAAACCTTCTGTATTGTTCACAGAAGGTGTCACGCTTCTTTTGGTTTATTCCTGGTATCGGCCCATGGTGCCAAACTTTTTTTTGTACAAATTTTGGAATTATAAAAAAAAACCATTGGTTCAATCATTTTGTTTTCAACGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGCTTTTCCTCTGCTTTATCCT