ORFeome > rangap1 ORF2 – XORFeome v1.0

rangap1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rangap1
Gene ID: 6464329
Gene Page ID: 489954
ORF Xenbase ID: 17292483

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126016
Original XGC clone length: 1758

Human orthology & disease relationships

NCBI Entrez ID: 5905
Ensembl gene IDs: ENSG00000100401
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 202400,226650,226730,273800

Library Location

Plate ID: GDExl11084
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ837462
dbEST ID: 79655164
Trimmed Sequence: ATGGCTGCTGAAGATATCGCACAGTTGGCAGATTGCTTGGCAAAGGCAAACGTTGGAGACGGAGAGCTGAGCTTTAAAGGGAAAACTCTGAAACTCAACACTGCCCAAGATGCCGAAGAAGTGATTCGGGAAATTGAAGAATATGAAGGGCTGCAGGCTCTGCGTCTGGAAGGCAATACTGTGGGAGTGGAGGCAGCTAAAGCAATAGCCGAAGTTCTGCAAAGGAAACCTGATCTGAAGCGTTGCCACTGGAGTGATATGTTTACAGGGAGGTTAAGGCCCGAGATTCCAACTGCTTTGAGATCTCTTGGTGATGCTTTGATTACAGCTGGAGCTCAATTGACTGAACTGGACTTAAGTGACAATGCATTTGGACCTGATGGAGTGCGTGGATTTGAAGCTCTTCTCAAAAGTCCAACTTGTTTTACTCTACAGGAGCTCAAACTGAACAACTGTGGAATGGGAATTGGGGGGAGGAAAGATCCTGGCTGCGGCACTAACAGAGTGCCACAAGAAGTCTAGCGCCCATGGTAAGCCTCTGGCATTGAAAGTGTTCATAGCAAGAAGGAACCGCTTGGAAAATGATGGTGCCACTGCACTCTCTGACGCTTTTCGGCTCATCGGCACCTTGGAAGAAATACACATGCCCTCAAAATGGCATTAATCCCGTCTGGCATCACCGCTTTTGCCAAACCTTTTAAAGCCAACTCCTTTGCTTAAATTTAATGACCGTTAATAATAAAACTTTAAAAAGAAAAAAGGGTAGCCAGGGGGAAGGGGGTGTAGGGCTTTTAGAGACGCCTGTCGGGCCACGCC
Full Trace Sequence: CGGGGGCCCAAATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGAAGATATCGCACAGTTGGCAGATTGCTTGGCAAAGGCAAACGTTGGAGACGGAGAGCTGAGCTTTAAAGGGAAAACTCTGAAACTCAACACTGCCCAAGATGCCGAAGAAGTGATTCGGGAAATTGAAGAATATGAAGGGCTGCAGGCTCTGCGTCTGGAAGGCAATACTGTGGGAGTGGAGGCAGCTAAAGCAATAGCCGAAGTTCTGCAAAGGAAACCTGATCTGAAGCGTTGCCACTGGAGTGATATGTTTACAGGGAGGTTAAGGCCCGAGATTCCAACTGCTTTGAGATCTCTTGGTGATGCTTTGATTACAGCTGGAGCTCAATTGACTGAACTGGACTTAAGTGACAATGCATTTGGACCTGATGGAGTGCGTGGATTTGAAGCTCTTCTCAAAAGTCCAACTTGTTTTACTCTACAGGAGCTCAAACTGAACAACTGTGGAATGGGAATTGGGGGGAGGAAAGATCCTGGCTGCGGCACTAACAGAGTGCCACAAGAAGTCTAGCGCCCATGGTAAGCCTCTGGCATTGAAAGTGTTCATAGCAAGAAGGAACCGCTTGGAAAATGATGGTGCCACTGCACTCTCTGACGCTTTTCGGCTCATCGGCACCTTGGAAGAAATACACATGCCCTCAAAATGGCATTAATCCCGTCTGGCATCACCGCTTTTGCCAAACCTTTTAAAGCCAACTCCTTTGCTTAAATTTAATGACCGTTAATAATAAAACTTTAAAAAGAAAAAAGGGTAGCCAGGGGGAAGGGGGTGTAGGGCTTTTAGAGACGCCTGTCGGGCCACGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGAAGATATCGCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837461
dbEST ID: 79655163
Trimmed Sequence: CAGATTATGAAGGTTGCACAGCAATGTGTGTCTGGCACTGGCGTTATTTTCCAGGACACCGTTGGGCTTGGAGATGAAAGCAAGAAGAGTAGAAGCAAGAGACTTTGGGAAGTAATTCTGCTGTACCATGTGATTCAGAGTTAGCAAAGGGCCATTTAAGTGTGGTATTGTTTTCATTTTGTCTTCACTCTTAAGAAGTCCCATTTGCACCAGTAGACTAGTGATAAACACATTTGCTTGGAAACCTCTGTTTTCAAAAGCCTCCTTCATTAAACCATCAATAGTTTCTTCAACAGCCGCCTTTATTTCACCATCCTCCCTATACACAGAGGAGACCTGAATGAAAGCTTGGACCACCTTTTCTGTATCTGCAACATTGACCTGTTGTGCTATCATTGCAGAACGTCTAGGACCCATGCGCACAAGTTTCTCTGGGGAAGGAAAGCTAAGAAAGGTGGATGCATCAACAGGAAGTTTAGGTGGAGAAGCTGGTGCTGATCCACTTAAGCATGGAATTTCTTTGGACTTCTCTTTGTTTTCATTATCTCCTCCTTCCTCCTCCTCTACTTCTTCTTCCTCCTCCTCAACTTCCTCATCATCATTTTCATCATCATCTTTCTCTTCATCATCGTCGCCATCACCATCAACATCCTCCTCCTCATTCCCCCTCACCCTCCTCAACAATTAAAGGAACCCAAAAAATTTTTGCCCATGTTTGAGGGGCGTCGAGGGATTTTCCCT
Full Trace Sequence: AAACCGGCTAATGACCATGTAATACGACTCACTATANGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGATTATGAAGGTTGCACAGCAATGTGTGTCTGGCACTGGCGTTATTTTCCAGGACACCGTTGGGCTTGGAGATGAAAGCAAGAAGAGTAGAAGCAAGAGACTTTGGGAAGTAATTCTGCTGTACCATGTGATTCAGAGTTAGCAAAGGGCCATTTAAGTGTGGTATTGTTTTCATTTTGTCTTCACTCTTAAGAAGTCCCATTTGCACCAGTAGACTAGTGATAAACACATTTGCTTGGAAACCTCTGTTTTCAAAAGCCTCCTTCATTAAACCATCAATAGTTTCTTCAACAGCCGCCTTTATTTCACCATCCTCCCTATACACAGAGGAGACCTGAATGAAAGCTTGGACCACCTTTTCTGTATCTGCAACATTGACCTGTTGTGCTATCATTGCAGAACGTCTAGGACCCATGCGCACAAGTTTCTCTGGGGAAGGAAAGCTAAGAAAGGTGGATGCATCAACAGGAAGTTTAGGTGGAGAAGCTGGTGCTGATCCACTTAAGCATGGAATTTCTTTGGACTTCTCTTTGTTTTCATTATCTCCTCCTTCCTCCTCCTCTACTTCTTCTTCCTCCTCCTCAACTTCCTCATCATCATTTTCATCATCATCTTTCTCTTCATCATCGTCGCCATCACCATCAACATCCTCCTCCTCATTCCCCCTCACCCTCCTCAACAATTAAAGGAACCCAAAAAATTTTTGCCCATGTTTGAGGGGCGTCGAGGGATTTTCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGATTATGAAGGTTGCACAG