ORFeome > rasl10b ORF1 – XORFeome v1.0

rasl10b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rasl10b
Gene ID: 865182
Gene Page ID: 478478
ORF Xenbase ID: 17292621

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127428
Original XGC clone length: 612

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ837392
dbEST ID: 79655094
Trimmed Sequence: ATGGTTACAACCTTCAAGATCGCTGTGCTCGGAGCCCAGGGGGTGGGAAAGACAGCCATTGTGCGGCAGTTCATGTACAACGAATTCAACGAAGCCTGTGTCCCTACAAACGCTCGCCGTGTCTTCCTGCCTGCTGTTGTCATGAATGGCCATGTCCACGAATTGCAGATCATGGACTTTCCTCCTATAACCTCTTTCCCAGTCAACACCCTACAGGAGTGGGCAGATTCATGTTGCCGGGGGCTCAGAAGTGCACATGCCTACATACTGGTTTATGACATCTGCTGCTTTGACAGCTTTGAATATATTAAGACCCTGAGGCAGCAGATCTTGGAAACAAGAGTAATTGGTACCACTGAAACCCCCATCATTATAGTGGGTAACAAACGGGACCTTCAGAGAGGCCGTGTCTTCCCTCGCTGGAATGTTTCCCATCTGGTAAAGAAAACTTGGAAATGTGGCTACATTGAATGCTCAGCCAAGTATAACTGGCATATACTGCTGCTCTTCAGTGAACTACTCAAGAGTGTGGGCTGCGCGCGATGCAAGCACGTGCATGCTGCAATACGCTTCCAAGGAGCACTGCGCCGCAGCCGATGCTCTATTATGTT
Full Trace Sequence: GGGGGGCCCAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTTACAACCTTCAAGATCGCTGTGCTCGGAGCCCAGGGGGTGGGAAAGACAGCCATTGTGCGGCAGTTCATGTACAACGAATTCAACGAAGCCTGTGTCCCTACAAACGCTCGCCGTGTCTTCCTGCCTGCTGTTGTCATGAATGGCCATGTCCACGAATTGCAGATCATGGACTTTCCTCCTATAACCTCTTTCCCAGTCAACACCCTACAGGAGTGGGCAGATTCATGTTGCCGGGGGCTCAGAAGTGCACATGCCTACATACTGGTTTATGACATCTGCTGCTTTGACAGCTTTGAATATATTAAGACCCTGAGGCAGCAGATCTTGGAAACAAGAGTAATTGGTACCACTGAAACCCCCATCATTATAGTGGGTAACAAACGGGACCTTCAGAGAGGCCGTGTCTTCCCTCGCTGGAATGTTTCCCATCTGGTAAAGAAAACTTGGAAATGTGGCTACATTGAATGCTCAGCCAAGTATAACTGGCATATACTGCTGCTCTTCAGTGAACTACTCAAGAGTGTGGGCTGCGCGCGATGCAAGCACGTGCATGCTGCAATACGCTTCCAAGGAGCACTGCGCCGCAGCCGATGCTCTATTATGTTGCCAACTTTCTTGTACAAAGTTGGCATTTATAGAAAACATTGCTTATCAATTTGTTGCAACCAAACAAGTCACTACCAGTCCAAATAAAATCATATTTGGCCATTCCACCTTAATATCCCGATATATTGGAGACAAAAAAAAAAAAAAAAAAAAAAAAAAATATAAACAAAAAAACCACGAACCCAGTCAAAAAAAAAATAACAACCTAAAAATTAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTACAACCTTCAAGATCGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837391
dbEST ID: 79655093
Trimmed Sequence: CATAATAGAGCATCGGTTGCGGCGCAGTGCTCCTTGGAAGCGTATTGCAGCATGCACGTGCTTGCATCGCGCGCAGCCCACACTCTTGAGTAGTTCACTGAAGAGCAGCAGTATATGCCAGTTATACTTGGCTGAGCATTCAATGTAGCCACATTTCCAAGTTTTCTTTACCAGATGGGAAACATTCCAGCGAGGGAAGACACGGCCTCTCTGAAGGTCCCGTTTGTTACCCACTATAATGATGGGGGTTTCAGTGGTACCAATTACTCTTGTTTCCAAGATCTGCTGCCTCAGGGTCTTAATATATTCAAAGCTGTCAAACCAGCAGATGTCATAAACCAGTATGTAGGCGTGTGCACTTCTGAGCCCCCCGCGACATGAATCTGCCCACTCCTGTAGGGTGTTGGCTGGGAGGAGGTTATAGGAGGAGGTCCATGATCGGGCGTGCGTTGAGATGGGCCGTCTTAACAGGACCACCCAGGGGGGCAGGCCGGGGGTGTGGAGGGACGGGGGCGGGGTTGAATACGGTGGAGGGGGACTCCCGGGGCGGGGGCGGGTGGTCCTNCCCCAGGCGGGGCGGGGCGAGGGAGGGGGAGGGTGGGGGGGTGGTAGGGGGGGGTGTGTGGGTGGGGGGAAGGGTGGGGAGGGAGAAAAAGAGAAGAGTTGAGGGGNNNNNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAGAAGAGAGGAGCAGGCATTGTATGCCCGCCGGCGCT
Full Trace Sequence: GAAACTGCTATTGACCATGGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATAATAGAGCATCGGTTGCGGCGCAGTGCTCCTTGGAAGCGTATTGCAGCATGCACGTGCTTGCATCGCGCGCAGCCCACACTCTTGAGTAGTTCACTGAAGAGCAGCAGTATATGCCAGTTATACTTGGCTGAGCATTCAATGTAGCCACATTTCCAAGTTTTCTTTACCAGATGGGAAACATTCCAGCGAGGGAAGACACGGCCTCTCTGAAGGTCCCGTTTGTTACCCACTATAATGATGGGGGTTTCAGTGGTACCAATTACTCTTGTTTCCAAGATCTGCTGCCTCAGGGTCTTAATATATTCAAAGCTGTCAAACCAGCAGATGTCATAAACCAGTATGTAGGCGTGTGCACTTCTGAGCCCCCCGCGACATGAATCTGCCCACTCCTGTAGGGTGTTGGCTGGGAGGAGGTTATAGGAGGAGGTCCATGATCGGGCGTGCGTTGAGATGGGCCGTCTTAACAGGACCACCCAGGGGGGCAGGCCGGGGGTGTGGAGGGACGGGGGCGGGGTTGAATACGGTGGAGGGGGACTCCCGGGGCGGGGGCGGGTGGTCCTNCCCCAGGCGGGGCGGGGCGAGGGAGGGGGAGGGTGGGGGGGTGGTAGGGGGGGGTGTGTGGGTGGGGGGAAGGGTGGGGAGGGAGAAAAAGAGAAGAGTTGAGGGGNNNNNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAGAAGAGAGGAGCAGGCATTGTATGCCCGCCGGCGCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATAATAGAGCATCGGTTGCGG