ORFeome > rassf1 ORF1 – XORFeome v1.0

rassf1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rassf1
Gene ID: 866377
Gene Page ID: 494690
ORF Xenbase ID: 17292633

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129553
Original XGC clone length: 822

Human orthology & disease relationships

NCBI Entrez ID: 11186
Ensembl gene IDs: ENSG00000068028
Directly associated (OMIM) disease MIM numbers: 211980
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,115150,125853,218040,607785,609942

Library Location

Plate ID: GDExl11086
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ837853
dbEST ID: 79655555
Trimmed Sequence: ATGGGGAAGGGAGACAAGGACACGACAGCTTTCGAAAGGACTTGGGACAGCACCTCCAGCAGTGGCTACTGCAGTCAGGAGGAGTCCGACCCGGAGCTGGAGCTCTTCTATACTGCGCGGACCTCTCTCTTCCCACGGAGGACTCCAGCTCGGCCCCTGGATGAAAAGCCAGAAAAGCAGCCACAGGCCCTGAGCAAGGCAGAGATAGATCAGAAAATAAAGAATTATAATTCTCAGATAAAGAGCAATCTCTTCATGAGCCTGAATAAGGACGGCTCGTTTACCGGATTCATTAAAGTTCAGCTGAAGCTTATCCGGCCCGTTTCTGTCCCAGCTTCCAAGAAGCCTTCATGTTTGCAGGATCGGAAAGGTAGCGTACGCTCTCAGCCGGTCGAACGCAGGACCTCCTTCTACCTTCCCAAAGATGCTTCAAAGCACCTGCATCTGAGTTCAAGGACGCCAGCTAGTGAGGTCATTCAGGCTCTGCTGCGGAAGTTTCCTGTGCTCGATAACCCCCCGAGGTTTCGCTCTGTTTTGAAGGGCGGGAACAGGGTGGACGAGTGTCCTTCTAAGAATTTATCGAATGGACAGGAGCCTCCTAACCCGCGTCTTTTCTCATGAACATGTGAGAGAGCATTAATTTTTGTTTTTGGGGAGAACGGAACAAGGAGAAGTCTTTTAGGTGGGAGGCGGCGTGGCGAGACCGGGAGATTTCTTTCCCCTTCCTCCCCTTTAAAGAAGAAAAGCCAAGAGAGGACAAAAATATTTCAGCGGGTTATCCCCAAGGTGCCCGGGGGGGG
Full Trace Sequence: TCGAGGGCCCCATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAAGGGAGACAAGGACACGACAGCTTTCGAAAGGACTTGGGACAGCACCTCCAGCAGTGGCTACTGCAGTCAGGAGGAGTCCGACCCGGAGCTGGAGCTCTTCTATACTGCGCGGACCTCTCTCTTCCCACGGAGGACTCCAGCTCGGCCCCTGGATGAAAAGCCAGAAAAGCAGCCACAGGCCCTGAGCAAGGCAGAGATAGATCAGAAAATAAAGAATTATAATTCTCAGATAAAGAGCAATCTCTTCATGAGCCTGAATAAGGACGGCTCGTTTACCGGATTCATTAAAGTTCAGCTGAAGCTTATCCGGCCCGTTTCTGTCCCAGCTTCCAAGAAGCCTTCATGTTTGCAGGATCGGAAAGGTAGCGTACGCTCTCAGCCGGTCGAACGCAGGACCTCCTTCTACCTTCCCAAAGATGCTTCAAAGCACCTGCATCTGAGTTCAAGGACGCCAGCTAGTGAGGTCATTCAGGCTCTGCTGCGGAAGTTTCCTGTGCTCGATAACCCCCCGAGGTTTCGCTCTGTTTTGAAGGGCGGGAACAGGGTGGACGAGTGTCCTTCTAAGAATTTATCGAATGGACAGGAGCCTCCTAACCCGCGTCTTTTCTCATGAACATGTGAGAGAGCATTAATTTTTGTTTTTGGGGAGAACGGAACAAGGAGAAGTCTTTTAGGTGGGAGGCGGCGTGGCGAGACCGGGAGATTTCTTTCCCCTTCCTCCCCTTTAAAGAAGAAAAGCCAAGAGAGGACAAAAATATTTCAGCGGGTTATCCCCAAGGTGCCCGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAAGGGAGACAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837852
dbEST ID: 79655554
Trimmed Sequence: GCCAGGTGTGCGCGATGCCAGTGCCTCCTGCATCTTCTCCCGGCACCTGGTGTAACGCTGAACAATCTGACGCATGTGCTCTTCTTCCTCACGCTGCAGAATGCGCAAGAAATTGTGCAGCTCCGGCATGCTGAATGCATCCCAATTGACTTCTCCTGTCTCGTTCTCCTTAAGCACAAAACTCAAAGTTTTCTCACATGGTCCTGAGAAAAGACGCAGCTTCAGAGGCTCCTCGTCATCCGTTAACTTCCTCAAGGACACTTGTCCACCCTGTTCTGCCCTTTCAAACAGAGCGAACTTCCTGGGGTTATCGAGCACAGTGAACTTCCGCAGCAGAGCCTGAATGACCTCACTAGCTGGCGTCCTTGAACTCAGATGCAGGTGCTTTGAAGCATCTTTGGGAAGGTAGAAGGAGGTCCTGCGTTTGACCGGCTGAGAGCGTACGCTACCTTTCCGATCCTGCAAACATGAAGGCTTCTTGGAAGCTGGGACAGAAACGGGCCGGATAAGCTTCACCTGAACTTTAGTGAATCCCGTAAACAAGCCGTCCTTATTCAGGCTCATGAAGAGATTGCTCTTTATCTGAAAATTATAATTCTTTATTTTCTGATCTATCTCTGCCTTGCTCAGGGCCGGTGGGTGCTTTTCTGGTTTTGATCCAGGGGCCGAGCTGAAGTCCTCCGTGAGAAAGAAAAAATCCCGCAGTAGAAAAGAACGCCCGCTCCGGGTCCGAACTCTCCTTACCGCGGTAGCCACTCCTGGAGGTGGTGTGGCAAGTCCTTTCGAAACAGGGAGGGCGTTGGCTCCTTTCCCCGGGGGCGGGGGGTTTTTAACAGGGGGGCGTTAGGGAAAAAAATACTTTTCCGTTGGTGGCGCGGGGGGGGTGCGATCAAAAAAAAAAAAAAAAAAATAAAATACCCAAGCCGGCAAAAGACCAGCAGTAGAAAAAAAAACAAAAAACGGCGAGGGAAGAGAGGGGAGGGTGATCTGAGAGTAGAGAGAGGAAAGGAGAGAGGAGAGCCGGGAGAGAAAGGAGAGGGCGGGGGGGAGGGGAGAGGAGGGGGGGGGGAGGAGGGGAGGCTGGCGTGGGGGGGCAGGAGGGGCTGCGATGGCGAGGGCGGGNAGTGGGGAGACGGGCGGATGAAAGGAGGAGCGGCGAGGGCAGTGGAGGGGAAGAGAAGGGAGGGGAGGGAGGAAGCTCGAGGAGAAAG
Full Trace Sequence: GGGGCGGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCAGGTGTGCGCGATGCCAGTGCCTCCTGCATCTTCTCCCGGCACCTGGTGTAACGCTGAACAATCTGACGCATGTGCTCTTCTTCCTCACGCTGCAGAATGCGCAAGAAATTGTGCAGCTCCGGCATGCTGAATGCATCCCAATTGACTTCTCCTGTCTCGTTCTCCTTAAGCACAAAACTCAAAGTTTTCTCACATGGTCCTGAGAAAAGACGCAGCTTCAGAGGCTCCTCGTCATCCGTTAACTTCCTCAAGGACACTTGTCCACCCTGTTCTGCCCTTTCAAACAGAGCGAACTTCCTGGGGTTATCGAGCACAGTGAACTTCCGCAGCAGAGCCTGAATGACCTCACTAGCTGGCGTCCTTGAACTCAGATGCAGGTGCTTTGAAGCATCTTTGGGAAGGTAGAAGGAGGTCCTGCGTTTGACCGGCTGAGAGCGTACGCTACCTTTCCGATCCTGCAAACATGAAGGCTTCTTGGAAGCTGGGACAGAAACGGGCCGGATAAGCTTCACCTGAACTTTAGTGAATCCCGTAAACAAGCCGTCCTTATTCAGGCTCATGAAGAGATTGCTCTTTATCTGAAAATTATAATTCTTTATTTTCTGATCTATCTCTGCCTTGCTCAGGGCCGGTGGGTGCTTTTCTGGTTTTGATCCAGGGGCCGAGCTGAAGTCCTCCGTGAGAAAGAAAAAATCCCGCAGTAGAAAAGAACGCCCGCTCCGGGTCCGAACTCTCCTTACCGCGGTAGCCACTCCTGGAGGTGGTGTGGCAAGTCCTTTCGAAACAGGGAGGGCGTTGGCTCCTTTCCCCGGGGGCGGGGGGTTTTTAACAGGGGGGCGTTAGGGAAAAAAATACTTTTCCGTTGGTGGCGCGGGGGGGGTGCGATCAAAAAAAAAAAAAAAAAAATAAAATACCCAAGCCGGCAAAAGACCAGCAGTAGAAAAAAAAACAAAAAACGGCGAGGGAAGAGAGGGGAGGGTGATCTGAGAGTAGAGAGAGGAAAGGAGAGAGGAGAGCCGGGAGAGAAAGGAGAGGGCGGGGGGGAGGGGAGAGGAGGGGGGGGGGAGGAGGGGAGGCTGGCGTGGGGGGGCAGGAGGGGCTGCGATGGCGAGGGCGGGNAGTGGGGAGACGGGCGGATGAAAGGAGGAGCGGCGAGGGCAGTGGAGGGGAAGAGAAGGGAGGGGAGGGAGGAAGCTCGAGGAGAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCAGGTGTGCGCGATG