ORFeome > rassf7 ORF2 – XORFeome v1.0

rassf7 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rassf7
Gene ID: 956646
Gene Page ID: 956639
ORF Xenbase ID: 17292663

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC111512
Original XGC clone length: 1284

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ837215
dbEST ID: 79654917
Trimmed Sequence: ATGGAGCTGAAGGTGTGGGTGGATGGAGTGCAACGTGTGGTCTGTGGTGTGTCGGAGCAAACGTCCTGCCAGGATGTCGTCATTGCTTTGGCCCAAGCCATAGGTCAAACTGGACGTTATGTCCTCATCCAGACTCTTCGGGACAAGGAGAGGCAACTTCTGCCCCATGAAAGGCCCCTGGAGTTCCTATCTAAGAGTGGACAATATGCCAATGATGTGCATTTCATTTTGAGGCGCACAGGACCAAGCTTAGCTGAACGTCCATCCTCCGATACAGGCCCTGTGCCCCCACAGAGGACTTTTGTCAGGTCGAGTTTGCCCCTAAATACTCAAACAGCTGGCACAGAAGTGACAAAGTCAAAGGAGCCCAAAAAATCATTGACATTTAATTTGGGGCCTATAGGTTCCACTGATATTTTGTCCAAGCACAGACAAAAGCAACTGAATGGCACTCCTGTTAAATATGGTTCCTCCCCCACGCCCCCCACCACAGAGGAGATATTCATAATGAAGTTACTGCAGCGGGATCAGCTAAACTCCATCCACATGCAAAATGTTGCTTTAACCAAGGAGAGCCGCACCTCGGAGTTAGAAATAGCGCGCCACCCCGTGCACCCAGCCAACCAGAAAAACCTAACTCTCCAAAAAAAAAAACCCCGAACTAAACTAACCATACAAAAAAAAGGATAAAATATTTTTGACGGGAAACTCATCCGGCCCGAAGGAGGGAAAAA
Full Trace Sequence: CGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCTGAAGGTGTGGGTGGATGGAGTGCAACGTGTGGTCTGTGGTGTGTCGGAGCAAACGTCCTGCCAGGATGTCGTCATTGCTTTGGCCCAAGCCATAGGTCAAACTGGACGTTATGTCCTCATCCAGACTCTTCGGGACAAGGAGAGGCAACTTCTGCCCCATGAAAGGCCCCTGGAGTTCCTATCTAAGAGTGGACAATATGCCAATGATGTGCATTTCATTTTGAGGCGCACAGGACCAAGCTTAGCTGAACGTCCATCCTCCGATACAGGCCCTGTGCCCCCACAGAGGACTTTTGTCAGGTCGAGTTTGCCCCTAAATACTCAAACAGCTGGCACAGAAGTGACAAAGTCAAAGGAGCCCAAAAAATCATTGACATTTAATTTGGGGCCTATAGGTTCCACTGATATTTTGTCCAAGCACAGACAAAAGCAACTGAATGGCACTCCTGTTAAATATGGTTCCTCCCCCACGCCCCCCACCACAGAGGAGATATTCATAATGAAGTTACTGCAGCGGGATCAGCTAAACTCCATCCACATGCAAAATGTTGCTTTAACCAAGGAGAGCCGCACCTCGGAGTTAGAAATAGCGCGCCACCCCGTGCACCCAGCCAACCAGAAAAACCTAACTCTCCAAAAAAAAAAACCCCGAACTAAACTAACCATACAAAAAAAAGGATAAAATATTTTTGACGGGAAACTCATCCGGCCCGAAGGAGGGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCTGAAGGTGTGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837214
dbEST ID: 79654916
Trimmed Sequence: GACATACACACCCTCAGGACTCAAACCGGACACCATTGGGTTCTGCAAATTCCGGGGGTGGCCCATGAGATGATTGGATGATGGTCGTGGAGGAGAATCCATGGGACCTCTGTTCCTCTGCTGGTTTTGCCACTGTACATCGTGAGGCTCAGCAAGAGAAGGATCTTCATCGGGCCGAAGCTGAGCGCTTGTCACGGTTGATCCTGTCTGAAGGATAAATTGTTGGAGGTTACACTGCCTGAGGTCTTTATTCACTTCATCCAGCTCCTGATTCCTGGCCTGAAGGTTTCTCCTGGCCTCCTCACAAGCCCTTTCCACGTTGGATAAGTTGCTCTCCAGCTGACGTCCTTGCCCAATCTTATTCTCCAGCTCTTTCCTCATCTTGATAACCATTTCTTCTAGGTCAGTAAAACTGGGCCCTGACGCACGTCTCTTGGAAGTCACTTTTTGGATCTCCAGCTCTAGTGCTTCTGTCCGCTCAGTGAACTCCGGTATTTTCACTGTGGAGGGGTCCCTTGTAGGGGGAAGGCTTTCACGTTTTCTCATGCCCCCCGTGGTTCCGCGGGCCCTTTGCCTTGGCAATTCAGCAATCCCAAAACGACAACAACTCCCTGCTTCAGGTGAAATACTCTGGGAACGGG
Full Trace Sequence: GGAAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTAGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACATACACACCCTCAGGACTCAAACCGGACACCATTGGGTTCTGCAAATTCCGGGGGTGGCCCATGAGATGATTGGATGATGGTCGTGGAGGAGAATCCATGGGACCTCTGTTCCTCTGCTGGTTTTGCCACTGTACATCGTGAGGCTCAGCAAGAGAAGGATCTTCATCGGGCCGAAGCTGAGCGCTTGTCACGGTTGATCCTGTCTGAAGGATAAATTGTTGGAGGTTACACTGCCTGAGGTCTTTATTCACTTCATCCAGCTCCTGATTCCTGGCCTGAAGGTTTCTCCTGGCCTCCTCACAAGCCCTTTCCACGTTGGATAAGTTGCTCTCCAGCTGACGTCCTTGCCCAATCTTATTCTCCAGCTCTTTCCTCATCTTGATAACCATTTCTTCTAGGTCAGTAAAACTGGGCCCTGACGCACGTCTCTTGGAAGTCACTTTTTGGATCTCCAGCTCTAGTGCTTCTGTCCGCTCAGTGAACTCCGGTATTTTCACTGTGGAGGGGTCCCTTGTAGGGGGAAGGCTTTCACGTTTTCTCATGCCCCCCGTGGTTCCGCGGGCCCTTTGCCTTGGCAATTCAGCAATCCCAAAACGACAACAACTCCCTGCTTCAGGTGAAATACTCTGGGAACGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACATACACACCCTCAGGACTCA