ORFeome > rbm25 ORF1 – XORFeome v1.0

rbm25 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rbm25
Gene ID: 865939
Gene Page ID: 490151
ORF Xenbase ID: 17292795

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124904
Original XGC clone length: 2445

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ837501
dbEST ID: 79655203
Trimmed Sequence: ATGTCGTATCCACCACATTTAAACCGCCCACCCATGGGGATTCCAACTCTTCCTCCAGGGATCCCACCACCTCAGTTTCCAGGCTTTCCACCACCTCCTGGTACTCCAATGATTCCGGTACCCATGAGTTTAATGGCACCTGGACCAACTGTATTGGTACCAACAGTATCTATGATTGGAAAACACATGGGGCCTCGGAAAGACATGATTGGGCTGAAGAATAAAGAAAATGATGAGAACAGTGGCCCTACTACCACGGTGTTTGTGGGAAACATATCTGAAAAGGCATCGGATATGCTCATCAAGCAGCTCTTAACTAAATGTGGCTTAGTTTTAAGCTGGAAGAGAGTGCAAGGTGCATCTGGGAAACTTCAAGCCTTTGGATTCTGTGAGTACAAAGAACCGGAATCTACTCTACGAGCTCTACGGATTCTCCATGATCTACAGAATGAGGAGAAAAAGCTGCTTGTAAAAGTTGATGCCAATACCAAATCTCAGATCGATGATTGGAAAGCAACTACACCGCATTACACTTAAACAGAATACGCAGAATCTGCAGAAGACGAATAAAAAAATATTCCCAAATCAACCCTGGAAACAAAAAATTATTGTGACATAAATCGTCGACACAGACCAAAAAAAATAGCATATTATCGATTACCAAACATGCACCAAAGAAATTCTTACAAAACTATTTAATAGGAATGCAAAGGTCCTGGCGAAAAAGAAAAAGTAAGTAATATGGAAAAATTCTGAGAAAATAA
Full Trace Sequence: CGAGGGCCCAAATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGTATCCACCACATTTAAACCGCCCACCCATGGGGATTCCAACTCTTCCTCCAGGGATCCCACCACCTCAGTTTCCAGGCTTTCCACCACCTCCTGGTACTCCAATGATTCCGGTACCCATGAGTTTAATGGCACCTGGACCAACTGTATTGGTACCAACAGTATCTATGATTGGAAAACACATGGGGCCTCGGAAAGACATGATTGGGCTGAAGAATAAAGAAAATGATGAGAACAGTGGCCCTACTACCACGGTGTTTGTGGGAAACATATCTGAAAAGGCATCGGATATGCTCATCAAGCAGCTCTTAACTAAATGTGGCTTAGTTTTAAGCTGGAAGAGAGTGCAAGGTGCATCTGGGAAACTTCAAGCCTTTGGATTCTGTGAGTACAAAGAACCGGAATCTACTCTACGAGCTCTACGGATTCTCCATGATCTACAGAATGAGGAGAAAAAGCTGCTTGTAAAAGTTGATGCCAATACCAAATCTCAGATCGATGATTGGAAAGCAACTACACCGCATTACACTTAAACAGAATACGCAGAATCTGCAGAAGACGAATAAAAAAATATTCCCAAATCAACCCTGGAAACAAAAAATTATTGTGACATAAATCGTCGACACAGACCAAAAAAAATAGCATATTATCGATTACCAAACATGCACCAAAGAAATTCTTACAAAACTATTTAATAGGAATGCAAAGGTCCTGGCGAAAAAGAAAAAGTAAGTAATATGGAAAAATTCTGAGAAAATAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGTATCCACCACATTTAAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837500
dbEST ID: 79655202
Trimmed Sequence: CTTCACAAGGCCAATCTTCTTTGCTTCGGTTTCGTAAATTAAAAGCCTCCACATTTTCACAATGAATACTTCTGCTTCTTCATCCAGAACCATTGCAACATCATCCAGAATGCTCTGAGGAGTACCGTGAGCCATTACTTTTGAACAGACAAAATCAACTAATGTTGCTTCTTCTTCGCCAATATATTCTATAATCTTCTTATTTATCCAGGGTCGAATTCGTCGCTCCATTAAGGTAGTGTCTACAATAGACCAGTCCAAAGGATACGCAAATAGCTCTGGTTTGGCTGTAGGGATTTTCTCTATAAGACTCTTGATATGTTTCCGCTTCTCTTCTGTGTTCACATTGTTTTTGGCTGAGGTTTTGTCATCGTCCTCATAATCCAACGGCACCAGTTTTCTTTTTCGAGGCACCTCATCACTATCTTCATCATCAAACTTGTTAAGAACACTATCCACAGGCAACTTCTTCCTCTTTGTTGTGTTTGGCTGACTGGGACTAATTAGGGGCAACCAAATCAAAGCTTAGTTCTATTTTCGACCTGCATTCCTCTGGTGGTTGCTGGCCTGCCGAAATCTCATGACGAAAGACGAAGCAAGAGGAAACAAAACACTCGTAGATTTCGAGCAAGACTAAGCTTTTCAAAACAAAAAAAAGTGACCAAAGGTGAAAACTGCTGGAGGAACTAATAAAATCTGTAGTATCTGGCAGAGTAATTTAAAACCATGAGAAAAAAAAAAGATAGAGGAATATTTCCTG
Full Trace Sequence: GGGAATATGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCACAAGGCCAATCTTCTTTGCTTCGGTTTCGTAAATTAAAAGCCTCCACATTTTCACAATGAATACTTCTGCTTCTTCATCCAGAACCATTGCAACATCATCCAGAATGCTCTGAGGAGTACCGTGAGCCATTACTTTTGAACAGACAAAATCAACTAATGTTGCTTCTTCTTCGCCAATATATTCTATAATCTTCTTATTTATCCAGGGTCGAATTCGTCGCTCCATTAAGGTAGTGTCTACAATAGACCAGTCCAAAGGATACGCAAATAGCTCTGGTTTGGCTGTAGGGATTTTCTCTATAAGACTCTTGATATGTTTCCGCTTCTCTTCTGTGTTCACATTGTTTTTGGCTGAGGTTTTGTCATCGTCCTCATAATCCAACGGCACCAGTTTTCTTTTTCGAGGCACCTCATCACTATCTTCATCATCAAACTTGTTAAGAACACTATCCACAGGCAACTTCTTCCTCTTTGTTGTGTTTGGCTGACTGGGACTAATTAGGGGCAACCAAATCAAAGCTTAGTTCTATTTTCGACCTGCATTCCTCTGGTGGTTGCTGGCCTGCCGAAATCTCATGACGAAAGACGAAGCAAGAGGAAACAAAACACTCGTAGATTTCGAGCAAGACTAAGCTTTTCAAAACAAAAAAAAGTGACCAAAGGTGAAAACTGCTGGAGGAACTAATAAAATCTGTAGTATCTGGCAGAGTAATTTAAAACCATGAGAAAAAAAAAAGATAGAGGAATATTTCCTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCACAAGGCCAATCTTC