ORFeome > rbm45 ORF1 – XORFeome v1.0

rbm45 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rbm45
Gene ID: 987240
Gene Page ID: 987234
ORF Xenbase ID: 17292831

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045039
Original XGC clone length: 1431

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ824192
dbEST ID: 79641894
Trimmed Sequence: ATGGAGGACAGCAGCGGGTTCCGTCCCTCGGCGGGTAACTTGGAGGACCCACCGAACAGCCGGGTATTCTTAGTGGTTAGCAAATATGCCACAGAGGATTTGATCAGGGAAAGGTTCTCCGATTTCGGCGATATCCAGGACATCTGGGTGGTAAAAGACAAGCAAACAAAGGAGTCTAAAGGGATCGCGTTTGTCAAATATGCCAAGTCTTCGCAGGCTTGTAGGGCAATGGAAGAGATGCACGGCCGGTGTCTCAGTGAGAGCACCAAACCCATCAAGGTGTTCATTGCACAGTCAAGAGGTTCTTCAAATCACAGGGATGTTGAGGATGAAGAGCTAACAAGAATTTTTGTAATGATTCCAAAGTCATACACAGAAGAAGATGTAAAGCAAAAATTTAAGGAATATGGACAAATCGAGTATTGCTCAATAATTAAAAATAAGAATACCGGTGAAAGTAAGGGTTTGGCATATGTGAGATTCCTCAAGCCCTCTCAGGCTGCTTTGGCTATAGAAAACTGTGACAGAAGCTTTAAGGCAATCTTGGCTGAGCCTAAGAACAAGGTGNANGTGGGAGTGGGTGGCGGGTGAAGCAGAGAATGACTACCACAACAGCGCAAGGCAAGAAACATGATACAGCATGACCACACTGCTGCTGCCACTGTGTTTTCTATGAATATGATTAATCATCGTATGACAAAAATACAGATGCCAAGACACAGGAGACCATATCCAGCCAACTAAAAATTTGTTTCAAAACTTTCCCATTGATTTCGGGACCAGGTGGCCAACTTATTTTTAATTTTATTCCTGGGGCTTTTGT
Full Trace Sequence: AAATACTGATTTCATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGACAGCAGCGGGTTCCGTCCCTCGGCGGGTAACTTGGAGGACCCACCGAACAGCCGGGTATTCTTAGTGGTTAGCAAATATGCCACAGAGGATTTGATCAGGGAAAGGTTCTCCGATTTCGGCGATATCCAGGACATCTGGGTGGTAAAAGACAAGCAAACAAAGGAGTCTAAAGGGATCGCGTTTGTCAAATATGCCAAGTCTTCGCAGGCTTGTAGGGCAATGGAAGAGATGCACGGCCGGTGTCTCAGTGAGAGCACCAAACCCATCAAGGTGTTCATTGCACAGTCAAGAGGTTCTTCAAATCACAGGGATGTTGAGGATGAAGAGCTAACAAGAATTTTTGTAATGATTCCAAAGTCATACACAGAAGAAGATGTAAAGCAAAAATTTAAGGAATATGGACAAATCGAGTATTGCTCAATAATTAAAAATAAGAATACCGGTGAAAGTAAGGGTTTGGCATATGTGAGATTCCTCAAGCCCTCTCAGGCTGCTTTGGCTATAGAAAACTGTGACAGAAGCTTTAAGGCAATCTTGGCTGAGCCTAAGAACAAGGTGNANGTGGGAGTGGGTGGCGGGTGAAGCAGAGAATGACTACCACAACAGCGCAAGGCAAGAAACATGATACAGCATGACCACACTGCTGCTGCCACTGTGTTTTCTATGAATATGATTAATCATCGTATGACAAAAATACAGATGCCAAGACACAGGAGACCATATCCAGCCAACTAAAAATTTGTTTCAAAACTTTCCCATTGATTTCGGGACCAGGTGGCCAACTTATTTTTAATTTTATTCCTGGGGCTTTTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGACAGCAGCGGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829497
dbEST ID: 79647199
Trimmed Sequence: GTAGGTTCTCTGTCTCTTGTTGGACTCATCTCTGGGAGAATCTGCCTGCATCACTTTGAGCTTTACACCATTTACCATCTTCCCATGTAAAACTGCAATAGCTTCATTGGCACTGGAGACATCCGCATATCTGGCATAGCCAACGTTTTTCCCCGGTACAATATAAACTTCAATAAGATTTCCGAAGCGACAGAAAGCATCTTCCATTATATCCAAGGATAATGGGTGTGGGTTGAACACAATAAACAGTCTCTCCTTTGACTGTGCATCACTTGGAGCTTTCTTTTTGATTGATGGAAGAGCTGCATCTGTCTGGAGCTGAGACGTAACTGGGGAGCCATATGCTCGTTCATAAGGCGGTGCTGAAGGATAATGCTGTGAAGAGCCCCATACGAGTGAACTGACCTGTGCAGCCACCATCTGTGATGCCATTTTTCGAAGAAGTTCAGATCCATCTCCACCATCATTTAAGTAAGTGACCCCAAGACGATNTCCAGGTGGATACTCAAACCCATGCAGCTTGTACTTGGCATATATAGCGGATGAGATGTTCTGATATTGCACAATCGCATGCCCAAAGCTATTATAAGGATCTCGCTTGGACTCACAATATTTCAGAACAGGGATCAGATCAAATAAGTTGGGGCACTTGCTCCTGAATTCATCGAAAGTCTTGAAAACACTAATAATTCCCCTTGGAAATTGGTCCTCCCGGGGTTCCGGGGGATCCTGGATTTTTTTTGTTCTAAT
Full Trace Sequence: GCTGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGGTTCTCTGTCTCTTGTTGGACTCATCTCTGGGAGAATCTGCCTGCATCACTTTGAGCTTTACACCATTTACCATCTTCCCATGTAAAACTGCAATAGCTTCATTGGCACTGGAGACATCCGCATATCTGGCATAGCCAACGTTTTTCCCCGGTACAATATAAACTTCAATAAGATTTCCGAAGCGACAGAAAGCATCTTCCATTATATCCAAGGATAATGGGTGTGGGTTGAACACAATAAACAGTCTCTCCTTTGACTGTGCATCACTTGGAGCTTTCTTTTTGATTGATGGAAGAGCTGCATCTGTCTGGAGCTGAGACGTAACTGGGGAGCCATATGCTCGTTCATAAGGCGGTGCTGAAGGATAATGCTGTGAAGAGCCCCATACGAGTGAACTGACCTGTGCAGCCACCATCTGTGATGCCATTTTTCGAAGAAGTTCAGATCCATCTCCACCATCATTTAAGTAAGTGACCCCAAGACGATNTCCAGGTGGATACTCAAACCCATGCAGCTTGTACTTGGCATATATAGCGGATGAGATGTTCTGATATTGCACAATCGCATGCCCAAAGCTATTATAAGGATCTCGCTTGGACTCACAATATTTCAGAACAGGGATCAGATCAAATAAGTTGGGGCACTTGCTCCTGAATTCATCGAAAGTCTTGAAAACACTAATAATTCCCCTTGGAAATTGGTCCTCCCGGGGTTCCGGGGGATCCTGGATTTTTTTTGTTCTAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGGTTCTCTGTCTCTTGT