ORFeome > rbm5 ORF2 – XORFeome v1.0

rbm5 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rbm5
Gene ID: 494991
Gene Page ID: 494986
ORF Xenbase ID: 17292849

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126019
Original XGC clone length: 2502

Human orthology & disease relationships

NCBI Entrez ID: 10181
Ensembl gene IDs: ENSG00000003756
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,609065,609227

Library Location

Plate ID: GDExl11084
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ837356
dbEST ID: 79655058
Trimmed Sequence: ATGGGATCAGATAAACGTGTGAGTCGCAGTGAGCGGAGTGGAAGATATGGTTCAGGGTTTGATAGAGATGATCGTGATGATAGAGACAATAGGAGCCGTCGCAGAGATTCTGAATACAAGAGATACCGAGATGAACGGAGTGACCGCTATGATGATTACAGAGATTATGACAGTCCCGAACGTGATAGAATGCGTGACAGGGAGAGAAGGAACAGTGATCGATCAGAAGATGGCTATCATTCAGATGGTGACTATATGGACCATGACTACCGTCAGGACTATTACATGGATGAAAAAGAGAGCAAGACAATCATGCTGAGGGGACTCCCCATTAATATTAATGAGAATGATATTCGTGAGCTGGTGGAGTCTTTTGAGGGGCCACAGCCTGCTGATGTACGGCTGATGAAGAGAAAGACAGGTTTAAGCCGCGGTTTCGCCTTCGTGGAGTTTTATCACTTGCAAGATTCTACCAGCTGGATGGAAGCCAATCAGAAAAAGCTTGTAATCCAGGGAAAGACTATTGCCATGCATTACAGCAATCCACGACCCAGATTTGAGGACTGGCTGTGTAACAAGTGTGGCCTGTACAACTTTCAGCGAAGATTAAATGCTTCCGCTGTTGGGCAGGCGGAGCTGAATCTGATATAGAAGCCCCATCAGGGACATCTGAAGCTCCTCAGTCTGCTGATTACTATTATGAAAGTGGCTATGGTATCCCCGCCATAATCCTTTCGAAATTTTGGCCCCAAAAATGGAAAGGAATTCATTTCTTGGTTGGGCCGTTGTTT
Full Trace Sequence: GGGGGGCCCCAATAATTGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGATCAGATAAACGTGTGAGTCGCAGTGAGCGGAGTGGAAGATATGGTTCAGGGTTTGATAGAGATGATCGTGATGATAGAGACAATAGGAGCCGTCGCAGAGATTCTGAATACAAGAGATACCGAGATGAACGGAGTGACCGCTATGATGATTACAGAGATTATGACAGTCCCGAACGTGATAGAATGCGTGACAGGGAGAGAAGGAACAGTGATCGATCAGAAGATGGCTATCATTCAGATGGTGACTATATGGACCATGACTACCGTCAGGACTATTACATGGATGAAAAAGAGAGCAAGACAATCATGCTGAGGGGACTCCCCATTAATATTAATGAGAATGATATTCGTGAGCTGGTGGAGTCTTTTGAGGGGCCACAGCCTGCTGATGTACGGCTGATGAAGAGAAAGACAGGTTTAAGCCGCGGTTTCGCCTTCGTGGAGTTTTATCACTTGCAAGATTCTACCAGCTGGATGGAAGCCAATCAGAAAAAGCTTGTAATCCAGGGAAAGACTATTGCCATGCATTACAGCAATCCACGACCCAGATTTGAGGACTGGCTGTGTAACAAGTGTGGCCTGTACAACTTTCAGCGAAGATTAAATGCTTCCGCTGTTGGGCAGGCGGAGCTGAATCTGATATAGAAGCCCCATCAGGGACATCTGAAGCTCCTCAGTCTGCTGATTACTATTATGAAAGTGGCTATGGTATCCCCGCCATAATCCTTTCGAAATTTTGGCCCCAAAAATGGAAAGGAATTCATTTCTTGGTTGGGCCGTTGTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGATCAGATAAACGTGTGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837355
dbEST ID: 79655057
Trimmed Sequence: TTCCATTTCTGAGAATCGCGCAAACATTGCTTTCCTCACTGCATCCTTGTAGGAGTCTGATGTGTTCACTCCATAGGAGCTGCCCTTGGCTCCCAGACCAGCCCCTCTCATTCTGACCTGAGCCTGAATAGGAGCTGTGATTCCTTGACTCTTTCGGCCCAGTCCTGAGCCCTCCTTCCAGCCCATGGCCTGTAGCATCTTATTTCCTATATTGCTATTATCAATGCCATCCTTTGTAGGTTGCTCATAATTCACCACAGTAGGGGCAAATCTCTTGCGTTTGGGTTCTGGGGGCTCTGGAATTCCATATTTCACTCTTCTTTCTGCTGCTCTGTCTCTATACTTTGACTCTCTTTCGGTTTGTTCTGCTTCATACTCTTGTTCAGACAACTTTGATCTCCTATAGACTTCCAGGTTTTGCTTATGTAGGTCTGACAGCTGCTGATGTCTTGTCAGAGCATCTTTATTTGGGAATTGTCTGCGGCATAGAAGACATGCCAGCTTCTTCCAGTCCATCAACTTTTCATCATCCACTGCCCCAATAAATCTCTCATTCTCCTCTTCATTGTCACTATCACCACTATAAGCAGCAACCAAAAGCTGTATTTGGAGGCTTTTCTTCCTCAGTGTTAACCATCATCATCATATCTGGCAAAAACTGTCTCTCCCACAATGATCCCTTGCTTTTTCTCAAAC
Full Trace Sequence: GGAAAACCGCTATAGACCATGTAATACGACTCACTATAGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCATTTCTGAGAATCGCGCAAACATTGCTTTCCTCACTGCATCCTTGTAGGAGTCTGATGTGTTCACTCCATAGGAGCTGCCCTTGGCTCCCAGACCAGCCCCTCTCATTCTGACCTGAGCCTGAATAGGAGCTGTGATTCCTTGACTCTTTCGGCCCAGTCCTGAGCCCTCCTTCCAGCCCATGGCCTGTAGCATCTTATTTCCTATATTGCTATTATCAATGCCATCCTTTGTAGGTTGCTCATAATTCACCACAGTAGGGGCAAATCTCTTGCGTTTGGGTTCTGGGGGCTCTGGAATTCCATATTTCACTCTTCTTTCTGCTGCTCTGTCTCTATACTTTGACTCTCTTTCGGTTTGTTCTGCTTCATACTCTTGTTCAGACAACTTTGATCTCCTATAGACTTCCAGGTTTTGCTTATGTAGGTCTGACAGCTGCTGATGTCTTGTCAGAGCATCTTTATTTGGGAATTGTCTGCGGCATAGAAGACATGCCAGCTTCTTCCAGTCCATCAACTTTTCATCATCCACTGCCCCAATAAATCTCTCATTCTCCTCTTCATTGTCACTATCACCACTATAAGCAGCAACCAAAAGCTGTATTTGGAGGCTTTTCTTCCTCAGTGTTAACCATCATCATCATATCTGGCAAAAACTGTCTCTCCCACAATGATCCCTTGCTTTTTCTCAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCATTTCTGAGAATCGCGCAA