ORFeome > rbm7 ORF1 – XORFeome v1.0

rbm7 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rbm7
Gene ID: 6077985
Gene Page ID: 947266
ORF Xenbase ID: 17292855

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054991
Original XGC clone length: 756

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ839525
dbEST ID: 79657227
Trimmed Sequence: ATGGGAGCGGCCGAGGCGGATAGGGCATTGTTTGTCGGGAATTTGGACCCGCGAGCTACAGAAGAGCTGCTTTTTGAGTTATTTTTGCAGGCAGGCCCTGCATTTAGTGTTAAAATCCCAAAGGATAAAGATGGAAAACCAAAGCAGTTTGCTTTTGTGAATTTCAAGCACGAAGAGTCTGTTCCCTATGGAATGAGTCTACTAAATGGCATCAAACTGTTTGGAAGGCCTCTCAAAATACAATACAGATCAGGAAGTAAACACATTCAACAAGATGGCAATAATTCTCCTCATTCAACACACTTTAACGGCAATGGAAGTCCAACTGGTTCATCACCAAATGGAAGCAGGTATGACAGAAACGGAGATCACCTAAAATCTCCTGGACACTCTCCTGTTCAAAATTCACAGAGATCATTTTCTTCACCTGATAACCTTCAGAGACAAGCAGTGATAAACAATTTTATGTGGCAGCAGTCGTCTCGGTATGGAACAGGATCACAAGCACAATCACAGTCTAGCTACTCTCCACCTTCATCTCAAACGCATTATGATAAGTACAGCCAAAGTTCCCAGCAGTCTTCAAGGCTATATGATTCTTCTTCTGCCCAGCGCANAGACAGAGTGCATGGCTCTCATCCATATATGAGTGATGGCCACCATTAAGCCCGGGAGACGCACCACAGGGGGCCGTCATGAGGAGCACTACTATTAAAGATGAGCCTAATAAAAACCGGTGGCGGGTCTTCAGGACCCTTTGCCACTTTTTCTGGTAACAAGTTGGGCATTTATAAAAAAGACATTTGCCTTTATCCATTTTTGTTG
Full Trace Sequence: GACCCCAAATAATGGATTTTANTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAGCGGCCGAGGCGGATAGGGCATTGTTTGTCGGGAATTTGGACCCGCGAGCTACAGAAGAGCTGCTTTTTGAGTTATTTTTGCAGGCAGGCCCTGCATTTAGTGTTAAAATCCCAAAGGATAAAGATGGAAAACCAAAGCAGTTTGCTTTTGTGAATTTCAAGCACGAAGAGTCTGTTCCCTATGGAATGAGTCTACTAAATGGCATCAAACTGTTTGGAAGGCCTCTCAAAATACAATACAGATCAGGAAGTAAACACATTCAACAAGATGGCAATAATTCTCCTCATTCAACACACTTTAACGGCAATGGAAGTCCAACTGGTTCATCACCAAATGGAAGCAGGTATGACAGAAACGGAGATCACCTAAAATCTCCTGGACACTCTCCTGTTCAAAATTCACAGAGATCATTTTCTTCACCTGATAACCTTCAGAGACAAGCAGTGATAAACAATTTTATGTGGCAGCAGTCGTCTCGGTATGGAACAGGATCACAAGCACAATCACAGTCTAGCTACTCTCCACCTTCATCTCAAACGCATTATGATAAGTACAGCCAAAGTTCCCAGCAGTCTTCAAGGCTATATGATTCTTCTTCTGCCCAGCGCANAGACAGAGTGCATGGCTCTCATCCATATATGAGTGATGGCCACCATTAAGCCCGGGAGACGCACCACAGGGGGCCGTCATGAGGAGCACTACTATTAAAGATGAGCCTAATAAAAACCGGTGGCGGGTCTTCAGGACCCTTTGCCACTTTTTCTGGTAACAAGTTGGGCATTTATAAAAAAGACATTTGCCTTTATCCATTTTTGTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGCGGCCGAGGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839524
dbEST ID: 79657226
Trimmed Sequence: GTGTCTTGAAGACCGCCACCTGTTGTCATAGGCTCTATCTTCATAGTAGTGCTCCTCATGACGGCCCCTGTGGTGCGTCTCCCGGCTGTAATGGTGGCCATCACTCATATATGGATGAGAGCCATGCACTCTGTCTTTGCGCTGGGCAGAAAAAGAATCATATAGCCTTGAAGACTGCTGGGAACTTTGGCTGTACTTATCATAATGCGTTTGAGATGAAGGTGGAGAGTAGCTAGACTGTGATTGTGCTTGTGATCCTGTTCCATACCGAGACGACTGCTGCCACATAAAATTGTTTATCACTGCTTGTCTCTGAAGGTTATCAGGTGAAGAAAATGATCTCTGTGAATTTTGAACAGGAGAGTGTCCAGGAGATTTTAGGTGATCTCCGTTTCTGTCATACCTGCTTCCATTTGGTGATGAACCAGTTGGACTTCCATTGCCGTTAAAGTGTGTTGAATGAGGAGAATTATTGCCATCTTGTTGAATGTGTTTACTTCCTGATCTGTATTGTATTTTGAGAGGCCTTCCAAACGTTTGATGCCCTTTAGTATACTCATTCCATAGGGAACAAACTCTTCGTGCTTTAAATTCACAAAGCAAACTGCTTTTGTTTTCCATCTTTATTCTTTGGGATTTTTACACTAAATGGAGGGACCTGCCCGGAAAAAAAACTCAAAAAACAACCTCTGCTGTAAGCCCCCGGGTCCCAGATTCCGGAGCGAACAAATGACCCATATCCGCCCTTGCCCCCGCCTCCCTTTGGCGGGG
Full Trace Sequence: AAACATGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGTCTTGAAGACCGCCACCTGTTGTCATAGGCTCTATCTTCATAGTAGTGCTCCTCATGACGGCCCCTGTGGTGCGTCTCCCGGCTGTAATGGTGGCCATCACTCATATATGGATGAGAGCCATGCACTCTGTCTTTGCGCTGGGCAGAAAAAGAATCATATAGCCTTGAAGACTGCTGGGAACTTTGGCTGTACTTATCATAATGCGTTTGAGATGAAGGTGGAGAGTAGCTAGACTGTGATTGTGCTTGTGATCCTGTTCCATACCGAGACGACTGCTGCCACATAAAATTGTTTATCACTGCTTGTCTCTGAAGGTTATCAGGTGAAGAAAATGATCTCTGTGAATTTTGAACAGGAGAGTGTCCAGGAGATTTTAGGTGATCTCCGTTTCTGTCATACCTGCTTCCATTTGGTGATGAACCAGTTGGACTTCCATTGCCGTTAAAGTGTGTTGAATGAGGAGAATTATTGCCATCTTGTTGAATGTGTTTACTTCCTGATCTGTATTGTATTTTGAGAGGCCTTCCAAACGTTTGATGCCCTTTAGTATACTCATTCCATAGGGAACAAACTCTTCGTGCTTTAAATTCACAAAGCAAACTGCTTTTGTTTTCCATCTTTATTCTTTGGGATTTTTACACTAAATGGAGGGACCTGCCCGGAAAAAAAACTCAAAAAACAACCTCTGCTGTAAGCCCCCGGGTCCCAGATTCCGGAGCGAACAAATGACCCATATCCGCCCTTGCCCCCGCCTCCCTTTGGCGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGTCTTGAAGACCGCC