ORFeome > rbmx2 ORF1 – XORFeome v1.0

rbmx2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rbmx2
Gene ID: 5891794
Gene Page ID: 5891738
ORF Xenbase ID: 17292885

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056844
Original XGC clone length: 819

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ839331
dbEST ID: 79657033
Trimmed Sequence: ATGAATCCTCTAACTAAGGTGAAGCTGATTAATGAACTAAATGCCCGTGAAGCAAGTCTGGGTGTGAAAGATTCTGTATCCTGGCATCAAGACTACAAAGACAGTGCATGGATATTTATAGGAGGTCTTCCCTTTGAGTTAACAGAAGGAGATGTGATCTGTGTCTTCTCACAGTATGGGGAGGTTGTAAATATTAATCTGGCCCGTGATAAATCTTCAGGCCGTTCTCGTGGATTTTGCTTTGTGTGTTTTGAGGATCAGAGAAGCACTGTATTGGCCGTGGATAATCTCAATGGCATAAAGTTAAAGGGGCGCACAATCCGTGTAGATCATGTTGCTAATTACCGTCCTCCGAAGGATGCAGAAGACATTGATGAAATTACACAAACTCTTAGAGAAAAAGGATGTGCGGCACGGACTCCATCCCCAACGTCATCCTCACAGGATGAAGAGGAAGAGCCACCAAGGAAAAAGAAAGATAAAAAAAAAAAAAAAAAAAAACCCGGGAGGAAAAAGGAAAAAACCCCAACCCCCCTCCCCAAATTTTTAAACGGGACCCCTGTGATTCCGCCTATTAAAAAAACCCAGAAAAAAGAAAAAAGTTTCCAAGGGGGCCCCCAAAAAACCTCAAAACCTTTAAAGAAAAAAAAAGACTCCCGCAAAAAGAAATAAAAACAAAAGGTCTTCCCCGGGAATACCCAAAAAAAACAACCAAAGGGCAAAAAAAAAAAAAAAAAAAAAATTTTAAACCCCCAAAGGGCCCAAAGAAAAAGGTTAAAAAAAAAACCACCCAAAAAAAAAAAAAAAAAAAAAGGAGAAAAGAAAGCCAA
Full Trace Sequence: CGTGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATCCTCTAACTAAGGTGAAGCTGATTAATGAACTAAATGCCCGTGAAGCAAGTCTGGGTGTGAAAGATTCTGTATCCTGGCATCAAGACTACAAAGACAGTGCATGGATATTTATAGGAGGTCTTCCCTTTGAGTTAACAGAAGGAGATGTGATCTGTGTCTTCTCACAGTATGGGGAGGTTGTAAATATTAATCTGGCCCGTGATAAATCTTCAGGCCGTTCTCGTGGATTTTGCTTTGTGTGTTTTGAGGATCAGAGAAGCACTGTATTGGCCGTGGATAATCTCAATGGCATAAAGTTAAAGGGGCGCACAATCCGTGTAGATCATGTTGCTAATTACCGTCCTCCGAAGGATGCAGAAGACATTGATGAAATTACACAAACTCTTAGAGAAAAAGGATGTGCGGCACGGACTCCATCCCCAACGTCATCCTCACAGGATGAAGAGGAAGAGCCACCAAGGAAAAAGAAAGATAAAAAAAAAAAAAAAAAAAAACCCGGGAGGAAAAAGGAAAAAACCCCAACCCCCCTCCCCAAATTTTTAAACGGGACCCCTGTGATTCCGCCTATTAAAAAAACCCAGAAAAAAGAAAAAAGTTTCCAAGGGGGCCCCCAAAAAACCTCAAAACCTTTAAAGAAAAAAAAAGACTCCCGCAAAAAGAAATAAAAACAAAAGGTCTTCCCCGGGAATACCCAAAAAAAACAACCAAAGGGCAAAAAAAAAAAAAAAAAAAAAATTTTAAACCCCCAAAGGGCCCAAAGAAAAAGGTTAAAAAAAAAACCACCCAAAAAAAAAAAAAAAAAAAAAGGAGAAAAGAAAGCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATCCTCTAACTAAGGTGAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839330
dbEST ID: 79657032
Trimmed Sequence: CACCCTTCTGCCTCTTTCGGTCCTTCCCTTTGATCTTTGCTCTTGCTGCTCTCTGTACCTATCTCGTGGCATTTGCTGCTCACACTCTTTGTATTTCTCTTTTTGCCTGTGCTGTTCTTTATGCTTATCCTGAGAAGCACCTTTGCTGTTACTCCTTTTGCGAGAGCCTCTATCTTCCTCCAAGGCTCTAGAGTTTTCTGGTGCCACCTTGGAAACCTTCTCCGTTGTCCTGGCTCTGTCATAGGCAGAATCCACAGGTTCCTGTTTAATATATTTGGTAGTGCTGTTGCTGCTCTCTCCCTCTTTCCTCCTGCTTTTATCTTTTTTTTTTTTTTAATTTTTTTTTTCCTTGGGGGGCCCTCCCCTTCCCCCCGGGAAGAAGAAGTTGGGGAAGGAATCCGGGCCCCCACCCCTTTTTCCCCAAAAATTTGGGTAATTTTCCCAATGGCCTCCGCCCCCCCCCAAAGAAGGGAAATAAAAAAAAAAATTAAACGGATTGGGCGCCCCTTTAACTTTTTGCCCTTTAAAATAACCACGGGCAAAAGAAGGTGCTCCTGGAAACTCAAAACCCAAAAGAGAAAATCCCAAAAAAGCGCCGGAAAAATAAACAGGGGCCAAAATAAGATTAAAAAACCCCCCAATCGGGGAAAAAAACAAAAAAAACATTCCTTTTTTTAAACCAAGGGGGAAAAACCCCGAAAAATAACCCCACCAATTCTTTTTGGAATTCTGTGAAGGCCGGAGAACAAAAATCTTAACCCCCCCCAAATATCTCCTTCGAGGG
Full Trace Sequence: GGAGTACCANGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACCCTTCTGCCTCTTTCGGTCCTTCCCTTTGATCTTTGCTCTTGCTGCTCTCTGTACCTATCTCGTGGCATTTGCTGCTCACACTCTTTGTATTTCTCTTTTTGCCTGTGCTGTTCTTTATGCTTATCCTGAGAAGCACCTTTGCTGTTACTCCTTTTGCGAGAGCCTCTATCTTCCTCCAAGGCTCTAGAGTTTTCTGGTGCCACCTTGGAAACCTTCTCCGTTGTCCTGGCTCTGTCATAGGCAGAATCCACAGGTTCCTGTTTAATATATTTGGTAGTGCTGTTGCTGCTCTCTCCCTCTTTCCTCCTGCTTTTATCTTTTTTTTTTTTTTAATTTTTTTTTTCCTTGGGGGGCCCTCCCCTTCCCCCCGGGAAGAAGAAGTTGGGGAAGGAATCCGGGCCCCCACCCCTTTTTCCCCAAAAATTTGGGTAATTTTCCCAATGGCCTCCGCCCCCCCCCAAAGAAGGGAAATAAAAAAAAAAATTAAACGGATTGGGCGCCCCTTTAACTTTTTGCCCTTTAAAATAACCACGGGCAAAAGAAGGTGCTCCTGGAAACTCAAAACCCAAAAGAGAAAATCCCAAAAAAGCGCCGGAAAAATAAACAGGGGCCAAAATAAGATTAAAAAACCCCCCAATCGGGGAAAAAAACAAAAAAAACATTCCTTTTTTTAAACCAAGGGGGAAAAACCCCGAAAAATAACCCCACCAATTCTTTTTGGAATTCTGTGAAGGCCGGAGAACAAAAATCTTAACCCCCCCCAAATATCTCCTTCGAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCCTTCTGCCTCTTTC