ORFeome > rccd1 ORF1 – XORFeome v1.0

rccd1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rccd1
Gene ID: 877115
Gene Page ID: 877110
ORF Xenbase ID: 17292969

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129717
Original XGC clone length: 1062

Human orthology & disease relationships

NCBI Entrez ID: 91433
Ensembl gene IDs: ENSG00000166965
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 230350,260920,604232

Library Location

Plate ID: GDExl11092
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ838990
dbEST ID: 79656692
Trimmed Sequence: ATGTCATGGTATGGCTTCGGCTACAGGGGCTTTGAGCAGCTGGGACTCGGGGGGAAGATCAGCCTCGAGCTCCCGGAACCAATTCTATTAGAAGAAGACGCAGACGCTCCCGAAGGCATAAAAGTGAGCAAAGCTGTTCCCTCATGGAGTTACTCTGCCTTCTTGACAGAGGACGGATCCCTGCTTCTCTCTGGCTCCATCGCTGTTTCCCCCAACAAGTATCTCCACTTTAAGGGGTTGCATTGTGTTGATGTCCTCCCTGCTGAGAAGTACCTTGTGCTGCAACTGAAACATGGACTGCAGTGTTGGGAGACTAAGGCTTTTACTGCTGAGGGACCACAAGCAGAACCAATGTGGAAAATGGATCTTCCTCCTGCACATAACTCATCCTTCCCCTTGGTAACCAATGGATATATAGTCCCCAAACCTCCTTTCTTCAGAGAACTTCCCAGTAAAATCCAAGCACACAAGCTGGCTCTAGGAAACGAGCATGCCGTACTGCTCACATCACACTGGACTCTGCTCACCTGGGGAGCTGGAAGGCATGGTCAGCTTGGACATGGAGATCTGGAGGATGTGGAAGAGCCTCGTATTGTAGATGCTCTGCATGGGGTGCCGGTGAGGGAAATAGCTGCAGGAGGCTGGGATTCTGGTTTCCTCATTTTGGGGACTTTTAGGGTTGGGGATGGAAGGAATCAGGGCACCTTGGAATTTCCCTGCAATCTCGGGAATGTTGGCCAAAGGAACGAACAGTTCCCACCCAAAAGAAAAAATTGAGGGAAACGGGAAGGAATTATAGAAAAATTCAGGCCTTTCCCCCCCCTCTGGATCGGCCGC
Full Trace Sequence: GGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCATGGTATGGCTTCGGCTACAGGGGCTTTGAGCAGCTGGGACTCGGGGGGAAGATCAGCCTCGAGCTCCCGGAACCAATTCTATTAGAAGAAGACGCAGACGCTCCCGAAGGCATAAAAGTGAGCAAAGCTGTTCCCTCATGGAGTTACTCTGCCTTCTTGACAGAGGACGGATCCCTGCTTCTCTCTGGCTCCATCGCTGTTTCCCCCAACAAGTATCTCCACTTTAAGGGGTTGCATTGTGTTGATGTCCTCCCTGCTGAGAAGTACCTTGTGCTGCAACTGAAACATGGACTGCAGTGTTGGGAGACTAAGGCTTTTACTGCTGAGGGACCACAAGCAGAACCAATGTGGAAAATGGATCTTCCTCCTGCACATAACTCATCCTTCCCCTTGGTAACCAATGGATATATAGTCCCCAAACCTCCTTTCTTCAGAGAACTTCCCAGTAAAATCCAAGCACACAAGCTGGCTCTAGGAAACGAGCATGCCGTACTGCTCACATCACACTGGACTCTGCTCACCTGGGGAGCTGGAAGGCATGGTCAGCTTGGACATGGAGATCTGGAGGATGTGGAAGAGCCTCGTATTGTAGATGCTCTGCATGGGGTGCCGGTGAGGGAAATAGCTGCAGGAGGCTGGGATTCTGGTTTCCTCATTTTGGGGACTTTTAGGGTTGGGGATGGAAGGAATCAGGGCACCTTGGAATTTCCCTGCAATCTCGGGAATGTTGGCCAAAGGAACGAACAGTTCCCACCCAAAAGAAAAAATTGAGGGAAACGGGAAGGAATTATAGAAAAATTCAGGCCTTTCCCCCCCCTCTGGATCGGCCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCATGGTATGGCTTCGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838989
dbEST ID: 79656691
Trimmed Sequence: GCGTTCTGCACAGAATACATATGTGCTCCAATTTCTACAAATCACATCATTAACACAAAGGTGCTTCACAGAAAAATAATGAACTAGTTTGGGCTGATCCAAGCTGATTGTATCCCCATGTCCAAGTTGTCCGTATTTACCCCAACCCCATGTATACAGCTCTCCAGATCGTGATACGGCCGCTGTGTGTCTTGATCCACAGCTAATCTTGGATGCGTCCGATTCCTGAGGCAGATCGATCAAGGCTGGGAAGGCCTGAATTGTGATAAACTCATCCGTGTTCCCTAATTCATCCTCTAGGTGTGACTGTTCAGTGCTTGTGCCTACATTGCTGAGATTTGCAGGGAAGTCCAAGCTGGCCTGATTCATTCCATCCCCACGTGTAAATGTCCCCACACTGATGGAAGCAGAATGCCAGCCTCCTGCAGCTACTTCCCTCATTGGCACCCCATGCAGAGCATCTACNATACGAGGCTCTTCCACATCCTCCAGATCTCCATGTCCGAGCTGACCATGCCTTCCAGCTCCCCAGGTGAGCAGAGTCCAGTGTGATGTGAGCAGTACGGCATGCTCGTTTCCTAGAGCCAACTTGTGTGCTTGGATTTTACCGGGAAATTTCTCTGAAGAAAGGAAGGTTTGGGGGACAATGTTTCCTTTGTTAACCAAGGGGGAAGGAAGAAGTTATGTTGCCAGAAAAAAAAAACCATTTTTCCAACATTTGTTTCCTTCTTTGGGGGGTCCGCCTCCCCGGGGGAAAGCCCTTTATTCCCCC
Full Trace Sequence: GAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGTTCTGCACAGAATACATATGTGCTCCAATTTCTACAAATCACATCATTAACACAAAGGTGCTTCACAGAAAAATAATGAACTAGTTTGGGCTGATCCAAGCTGATTGTATCCCCATGTCCAAGTTGTCCGTATTTACCCCAACCCCATGTATACAGCTCTCCAGATCGTGATACGGCCGCTGTGTGTCTTGATCCACAGCTAATCTTGGATGCGTCCGATTCCTGAGGCAGATCGATCAAGGCTGGGAAGGCCTGAATTGTGATAAACTCATCCGTGTTCCCTAATTCATCCTCTAGGTGTGACTGTTCAGTGCTTGTGCCTACATTGCTGAGATTTGCAGGGAAGTCCAAGCTGGCCTGATTCATTCCATCCCCACGTGTAAATGTCCCCACACTGATGGAAGCAGAATGCCAGCCTCCTGCAGCTACTTCCCTCATTGGCACCCCATGCAGAGCATCTACNATACGAGGCTCTTCCACATCCTCCAGATCTCCATGTCCGAGCTGACCATGCCTTCCAGCTCCCCAGGTGAGCAGAGTCCAGTGTGATGTGAGCAGTACGGCATGCTCGTTTCCTAGAGCCAACTTGTGTGCTTGGATTTTACCGGGAAATTTCTCTGAAGAAAGGAAGGTTTGGGGGACAATGTTTCCTTTGTTAACCAAGGGGGAAGGAAGAAGTTATGTTGCCAGAAAAAAAAAACCATTTTTCCAACATTTGTTTCCTTCTTTGGGGGGTCCGCCTCCCCGGGGGAAAGCCCTTTATTCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGTTCTGCACAGAATACAT