ORFeome > rdh7.2 ORF1 – XORFeome v1.0

rdh7.2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rdh7.2
Gene ID: 1007890
Gene Page ID: 1007885
ORF Xenbase ID: 17293059

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082896
Original XGC clone length: 954

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ839818
dbEST ID: 79657520
Trimmed Sequence: ATGTGGGTCCTTCTACTGCTACTTGTGCCTCTGAGTCTCCTGTATAGGTGGTACAAGGACAGACATATTTTGGACAATCTAACTGATAAATATGTGTTGATCACTGGCTGTGACTCTGGATTTGGGAACCTGTTAGCAAGAAAGCTGGATAGACGTGGGATACATGTGCTGGCAGCCTGTCTGACCGATAGAGGGGCTGAAGAACTAAAAAAGCAGACATCAAGCGGGCTACAGACAATTCTCCTGGATGTAACTGACAGCAAGAGTGTGAAATCTGCAGAAAAGTGGGCTAGCCAGATTGTTGGAGATAAAGGGCTCTGGGGCTTAGTGAACAATGCAGGAATTAGTTTTCCTTGTGCTCCAAATGAATGGTTAACCAAAGAAGATTTTATAAAGATCATGAATGTAAACCTGTTAGGCCTTGTTGATGTGACAATCAATATGTTGCACCTTATCAGGAAAGCCCGAGGGCGTGTGGTAAATATAGCCAGCGTGGCAGGTAGAATAACTTTCTCTGGAGGGGGATATTGCATGTCCAAATACGGAGTGGAATCTTTCTCTGATAGTCTCANGCGTGAGATGAGGCCGTTCGGTGTAAAGGTGTCTATAGTGGAACCAGGCTTTTTTAAACCCAAATAACAAACACAAATTTATTAAAATCAAGTTTAGAAAAAGCCTTGAACAACACCACTGAAGAAATCCGCCAAAACTATTGACAAGAATACTTTTGAAAAATCTTGCAAGGGATTCCTAAAACGATTTTTTCCTTTGTGCAAAAGGGGAATTCTTTCATTTGGTTGAAACGAACTTG
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGGTCCTTCTACTGCTACTTGTGCCTCTGAGTCTCCTGTATAGGTGGTACAAGGACAGACATATTTTGGACAATCTAACTGATAAATATGTGTTGATCACTGGCTGTGACTCTGGATTTGGGAACCTGTTAGCAAGAAAGCTGGATAGACGTGGGATACATGTGCTGGCAGCCTGTCTGACCGATAGAGGGGCTGAAGAACTAAAAAAGCAGACATCAAGCGGGCTACAGACAATTCTCCTGGATGTAACTGACAGCAAGAGTGTGAAATCTGCAGAAAAGTGGGCTAGCCAGATTGTTGGAGATAAAGGGCTCTGGGGCTTAGTGAACAATGCAGGAATTAGTTTTCCTTGTGCTCCAAATGAATGGTTAACCAAAGAAGATTTTATAAAGATCATGAATGTAAACCTGTTAGGCCTTGTTGATGTGACAATCAATATGTTGCACCTTATCAGGAAAGCCCGAGGGCGTGTGGTAAATATAGCCAGCGTGGCAGGTAGAATAACTTTCTCTGGAGGGGGATATTGCATGTCCAAATACGGAGTGGAATCTTTCTCTGATAGTCTCANGCGTGAGATGAGGCCGTTCGGTGTAAAGGTGTCTATAGTGGAACCAGGCTTTTTTAAACCCAAATAACAAACACAAATTTATTAAAATCAAGTTTAGAAAAAGCCTTGAACAACACCACTGAAGAAATCCGCCAAAACTATTGACAAGAATACTTTTGAAAAATCTTGCAAGGGATTCCTAAAACGATTTTTTCCTTTGTGCAAAAGGGGAATTCTTTCATTTGGTTGAAACGAACTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGGTCCTTCTACTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839817
dbEST ID: 79657519
Trimmed Sequence: TACTCCTTGGGCTGGTTTAGGATTATCAATACCAAACAGAAAGTCTACTAGTGATGTAGGGAAATAGGAAAGAGGCAAGAAGAGCAGCTTTGCATCCCAGCCAGCAGAATAACGTGTCCGAGGATGTATCGCAGTGAGGGCATGCTCCAAGCAGTCGGTCACCAATGAAAGATCCCCTTTGCACAATGGAACAATCGTCTCAGATGCCTTGCACGATTTTTCAAAGTATTCCTGTCCATAGCTTTGGCGGATTTCCTCAGTGGTGTTGTTCCAGGCCTTTTCTAAACTTTGATTTACTAAATCTGTGTTTGTTATTTGTGTTTTAAAAAAGCCTGGTTCCACTATAGACACCTTTACACCGAACGGCCTCATCTCACGCCTGAGACTATCAGAGAAAGATTCCACTCCGTATTTGGACATGCAATATCCCCCTCCAGAGAAAGTTATTCTACCTGCCACGCTGGCTATATTTACCACACGCCCTCGGGCTTTCCTGATTAGGTGCAACATATTGATTGTCACATCAACAAGGCCTAACAGGTTTACATTCATGATCTTTATAAAATTCTTCTTTGGTTAACCATTCATTTGGAGCACAAGAAAAACTAATTCCTGCCATGTTCACTAAGCCCCAAAGCCCTTTATCTTCCCACATCTGGGCTAGCCCACTTTTTCTGCAAATTTCCAACCCCTTGCTGTCAATTAACCTCCCGGAAAAATTGTCTGTAAACCCCGCCTTTGAGTTTCCCGCCTTTTTTTTAAT
Full Trace Sequence: GAAACAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACTCCTTGGGCTGGTTTAGGATTATCAATACCAAACAGAAAGTCTACTAGTGATGTAGGGAAATAGGAAAGAGGCAAGAAGAGCAGCTTTGCATCCCAGCCAGCAGAATAACGTGTCCGAGGATGTATCGCAGTGAGGGCATGCTCCAAGCAGTCGGTCACCAATGAAAGATCCCCTTTGCACAATGGAACAATCGTCTCAGATGCCTTGCACGATTTTTCAAAGTATTCCTGTCCATAGCTTTGGCGGATTTCCTCAGTGGTGTTGTTCCAGGCCTTTTCTAAACTTTGATTTACTAAATCTGTGTTTGTTATTTGTGTTTTAAAAAAGCCTGGTTCCACTATAGACACCTTTACACCGAACGGCCTCATCTCACGCCTGAGACTATCAGAGAAAGATTCCACTCCGTATTTGGACATGCAATATCCCCCTCCAGAGAAAGTTATTCTACCTGCCACGCTGGCTATATTTACCACACGCCCTCGGGCTTTCCTGATTAGGTGCAACATATTGATTGTCACATCAACAAGGCCTAACAGGTTTACATTCATGATCTTTATAAAATTCTTCTTTGGTTAACCATTCATTTGGAGCACAAGAAAAACTAATTCCTGCCATGTTCACTAAGCCCCAAAGCCCTTTATCTTCCCACATCTGGGCTAGCCCACTTTTTCTGCAAATTTCCAACCCCTTGCTGTCAATTAACCTCCCGGAAAAATTGTCTGTAAACCCCGCCTTTGAGTTTCCCGCCTTTTTTTTAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACTCCTTGGGCTGGTTT