ORFeome > rdh9 ORF1 – XORFeome v1.0

rdh9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6252790
Gene Page ID:
ORF Xenbase ID: 17293065

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123191
Original XGC clone length: 960

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ838339
dbEST ID: 79656041
Trimmed Sequence: ATGTGGCTCCCCTTGATGGTGCTGGTGGTCCTGATCTTCCTGTATAGATGGAACAGGCAGAGACAAATACTGCCATTTCTGACAGACAAGTATGTGTTTATCACCGGCTGTGACTCTGGCTTTGGAAATGTGCTGGCAAAGCAGCTGGACAGACGTGGCCTTCGGGTGCTGGCAGCCTGTTTGACAGATAAAGGAGCAGAAGAGCTAAAAAAGGAGACTTCCAGTAGACTGAGGACAATTATCCTAGATATTTCTGACAGCCAGATGGTAACATCTGTTACTGAATGGATCACCAACACAGTTGGAAATGAAGGGCTCTGGGGCTTAGTAAATAATGCTGGGATTGGATTATGTGGTCCCAATGGACTGCAAAGAAAGGAGGATTTTGCAAAAGTGTTGGAAGTGAACTTACTGGGTACAATTGACGTGACATTGCACTTGCTACCTCTCATTCGAAGATCCAGGGGTCGCATTGTCAATGTATCTAGTGGCGCTGGGAGACTGGCTGTGACTGGTGGAGGATACTGTTTATCTAAGTACGGGGTGGAAGCTTTCTCTGACAGCCTACGAAGGGAGAATTTCAACTTTGGGGTTAAGGTTTCTATCCTAAAAACCAAGTGCCATTCGAACCCAAATGTCACAGGGCTGAAAATCGAAAAATAAACCTACCTTAAATATTGGAAACCCCCTCCCCCCCGAAATCCACGAAAAGATTATGGGAAAGCAATAAATCCCAACAACAAAGGCCCTGGTCCTGGAAAAACCTGGGTGAAAAAAATAACAATTTCCAAACTTTTAAAATTAAAGGTCACAAA
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGCTCCCCTTGATGGTGCTGGTGGTCCTGATCTTCCTGTATAGATGGAACAGGCAGAGACAAATACTGCCATTTCTGACAGACAAGTATGTGTTTATCACCGGCTGTGACTCTGGCTTTGGAAATGTGCTGGCAAAGCAGCTGGACAGACGTGGCCTTCGGGTGCTGGCAGCCTGTTTGACAGATAAAGGAGCAGAAGAGCTAAAAAAGGAGACTTCCAGTAGACTGAGGACAATTATCCTAGATATTTCTGACAGCCAGATGGTAACATCTGTTACTGAATGGATCACCAACACAGTTGGAAATGAAGGGCTCTGGGGCTTAGTAAATAATGCTGGGATTGGATTATGTGGTCCCAATGGACTGCAAAGAAAGGAGGATTTTGCAAAAGTGTTGGAAGTGAACTTACTGGGTACAATTGACGTGACATTGCACTTGCTACCTCTCATTCGAAGATCCAGGGGTCGCATTGTCAATGTATCTAGTGGCGCTGGGAGACTGGCTGTGACTGGTGGAGGATACTGTTTATCTAAGTACGGGGTGGAAGCTTTCTCTGACAGCCTACGAAGGGAGAATTTCAACTTTGGGGTTAAGGTTTCTATCCTAAAAACCAAGTGCCATTCGAACCCAAATGTCACAGGGCTGAAAATCGAAAAATAAACCTACCTTAAATATTGGAAACCCCCTCCCCCCCGAAATCCACGAAAAGATTATGGGAAAGCAATAAATCCCAACAACAAAGGCCCTGGTCCTGGAAAAACCTGGGTGAAAAAAATAACAATTTCCAAACTTTTAAAATTAAAGGTCACAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGCTCCCCTTGATGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838338
dbEST ID: 79656040
Trimmed Sequence: TGGTTTTTCTGTCGTTTGAATTGTTTTGAGTGTAGAGTGAAGAAGCACATAATCTGATATTGCTGTAGGCAGATAAGAAAGAGGGATAAAGTATAATTTGGAGTCCCATCCAGGGCTGTATCGAGTCCAGGGGAAAACAGCAGTAAGAGCGTGCTCCATGCAGTCTGTGACCTCAGTTAAGTTTGGACTTGCATATTCCACCAGTTTATCCAGACCATGGCATTGTTGCTGGATGTATTGCTCTCCATAACTCTCCTTGATCTCCTGGGGGAGGGCTTCCCATAGTTTAGTTAGGCTCATCTTTAGATTCTCAGCCTGTGACATTTGGGTTCTGAATGCACCTGGTTCTATGATAGAAACCTTTACCCCAAAGTTGTACATCTCCCTTCGTAGGCTGTCAGAGAAAGCTTCCACCCCGTACTTAGATAAACAGTATCCTCCACCAGTCACAGCCAGTCTCCCAGCGCCACTAGATACATTGACAATGCGACCCCTGGATCTTCGAATGAGAGGTAGCAAGTGCAATGTCACATCAATTGGTACCCGTAAGTTCACTTCCAAACACTTTTGCAAAAATCCTCTTTCCTTGCAGTCCATTTGGGACAAATAATCCAATCCCAACCATTATTTACTAAACCCCCCAAACCCCTTAATTTCCAACCTGTGTTGGTTAAACGTTTCCATAAACAAAAGGTTACCATCCTGGGCTTTCAAAAAAAATTCTAGGAAAAAATTGTTCCTTCAATCTTAACGGGAAAAATTTCCCCTTTT
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGTTTTTCTGTCGTTTGAATTGTTTTGAGTGTAGAGTGAAGAAGCACATAATCTGATATTGCTGTAGGCAGATAAGAAAGAGGGATAAAGTATAATTTGGAGTCCCATCCAGGGCTGTATCGAGTCCAGGGGAAAACAGCAGTAAGAGCGTGCTCCATGCAGTCTGTGACCTCAGTTAAGTTTGGACTTGCATATTCCACCAGTTTATCCAGACCATGGCATTGTTGCTGGATGTATTGCTCTCCATAACTCTCCTTGATCTCCTGGGGGAGGGCTTCCCATAGTTTAGTTAGGCTCATCTTTAGATTCTCAGCCTGTGACATTTGGGTTCTGAATGCACCTGGTTCTATGATAGAAACCTTTACCCCAAAGTTGTACATCTCCCTTCGTAGGCTGTCAGAGAAAGCTTCCACCCCGTACTTAGATAAACAGTATCCTCCACCAGTCACAGCCAGTCTCCCAGCGCCACTAGATACATTGACAATGCGACCCCTGGATCTTCGAATGAGAGGTAGCAAGTGCAATGTCACATCAATTGGTACCCGTAAGTTCACTTCCAAACACTTTTGCAAAAATCCTCTTTCCTTGCAGTCCATTTGGGACAAATAATCCAATCCCAACCATTATTTACTAAACCCCCCAAACCCCTTAATTTCCAACCTGTGTTGGTTAAACGTTTCCATAAACAAAAGGTTACCATCCTGGGCTTTCAAAAAAAATTCTAGGAAAAAATTGTTCCTTCAATCTTAACGGGAAAAATTTCCCCTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGTTTTTCTGTCGTTTGAATTGT