ORFeome > reep6 ORF1 – XORFeome v1.0

reep6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: reep6
Gene ID: 974928
Gene Page ID: 974920
ORF Xenbase ID: 17293101

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123300
Original XGC clone length: 567

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ837580
dbEST ID: 79655282
Trimmed Sequence: ATGCCTTCGTTCAAGGAGCGCCTCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGCGAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTTCGTTCAAGGAGCGCCTCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGCGAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCATTTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCCAGCTGATATCCGGCAAGGTTGAGTCGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTTCGTTCAAGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837579
dbEST ID: 79655281
Trimmed Sequence: TTTCAACTTTTCATTCTCCAAAGACTGGGTTACTGCTCCTTTGATTGCTCCTCTAGTGACTGATTCAGCCGTGTTTAGCGCCTGTCCTCCAAGGTCACTAACAACACTGTCCACTGTTCGATGGTGCTTCAGGAAGAATGGACGGATGAATCGTTCATATAGAATCTGAGAGCCATTCCATGAAAATGGAGCCATACACCAAACTAAGAAGCAACACTTGCCCAGATAGTAAAATGGAAACCAGAAGAATAATATGTCAGAGAAAAATTCAACTACACTGAACACACCATATACCACCCAGTATGTCAGCCATATCGTGTCATCTTTTTTATCTTGGCTTTCAATAGCTTTAATCGAAATATAGGCTGGGTACACAAAGCCAATCAGATTGCAGACAAGAGAAGCCCCATAGCCNAATATAAGGTACAGCCCCAGGGAGCAGATGGATCCCGTAGCAAGATAATACTTTTTGATGCCAGTTTTCGCCTCAGCTTTCCCCAATAATCGAGATACAAAGTTGTCTCCCTTGAGAAAGTTCTTGGAGGCGCTCCTTGAACGAAGGCATGGTGCCC
Full Trace Sequence: GGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCAACTTTTCATTCTCCAAAGACTGGGTTACTGCTCCTTTGATTGCTCCTCTAGTGACTGATTCAGCCGTGTTTAGCGCCTGTCCTCCAAGGTCACTAACAACACTGTCCACTGTTCGATGGTGCTTCAGGAAGAATGGACGGATGAATCGTTCATATAGAATCTGAGAGCCATTCCATGAAAATGGAGCCATACACCAAACTAAGAAGCAACACTTGCCCAGATAGTAAAATGGAAACCAGAAGAATAATATGTCAGAGAAAAATTCAACTACACTGAACACACCATATACCACCCAGTATGTCAGCCATATCGTGTCATCTTTTTTATCTTGGCTTTCAATAGCTTTAATCGAAATATAGGCTGGGTACACAAAGCCAATCAGATTGCAGACAAGAGAAGCCCCATAGCCNAATATAAGGTACAGCCCCAGGGAGCAGATGGATCCCGTAGCAAGATAATACTTTTTGATGCCAGTTTTCGCCTCAGCTTTCCCCAATAATCGAGATACAAAGTTGTCTCCCTTGAGAAAGTTCTTGGAGGCGCTCCTTGAACGAAGGCATGGTGCCCACCTCTTTTGTACAAAGTTGGGCATATAAGAAAGCATTGGCTCATCAATTTTGTTGCCTCGAAACAGGTTGCGTATCGTTCAAAATAAAATCCTTAATATTGGGAAAACAAACAAAATAAACGGGACCGATC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCAACTTTTCATTCTCCAA