ORFeome > rere ORF1 – XORFeome v1.0

rere ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rere
Gene ID: 919911
Gene Page ID: 919901
ORF Xenbase ID: 17293131

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129057
Original XGC clone length: 4590

Human orthology & disease relationships

NCBI Entrez ID: 473
Ensembl gene IDs: ENSG00000142599
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 125370,140340

Library Location

Plate ID: GDExl11083
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ837423
dbEST ID: 79655125
Trimmed Sequence: ATGACTGCCGACAAAGAAAAGGATAAAGACAAGGACCGGGATCGGGACAGAGAGAGAGAAAAACGAGACAAGAACCGTGATGGGGAAAACTCAAGGCCACGTCGCAGTTGCACACTAGAAGGGGACAAGCAGTTGTT
Full Trace Sequence: GGTCCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCNTTGCAACAAATTGATGANCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTGCCGACAAAGAAAAGGATAAAGACAAGGACCGGGATCGGGACAGAGAGAGAGAAAAACGAGACAAGAACCGTGATGGGGAAAACTCAAGGCCACGTCGCAGTTGCACACTAGAAGGGGACAAGCAGTTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAATAAAACAAATATGAAAAAATATTCAGAGTATTATGTACATCATAGGGCCAAATGCTAGAACAGCCCGGACAGAAAAGCGGCGAGGTGGCTGCTCCCCTGGGTTGCGGGGTGGCTCACACCGTGGGGCACAACGAGGGCGCGTGCCTTGTGGATGTGAGCCTGGTCGGGGCGGACGCTGTGGTCGCAAGTATGTACGCGCTCACGGGGGTGGGCGGGAAGCGGGGATTGAACGGTTTTGGTGGTATCGTTTTGTGGGCGGTTTTCATGGCTTGTAAGGACAGTTTTGTTGGGGGCCGGGGCTAGGTTTTGGGTATTCAAGAAAAAAATTTCCTTTCCCCGGGGGGGGCCCTTGTTTTAATTTAATGAAAATAAAAAAGAGGGGGTGCGCCCCATGGCCTTCCCTTCTAAAAGAGTATGGTTGGGCTTTTGGTGGGGGCGACGCGCGGTGCGTGCCCCCCAATTTTTGCTCCCCCCCTCTTCTCTAGAGAGGGTGGGGGTGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTGCCGACAAAGAAAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837422
dbEST ID: 79655124
Trimmed Sequence: CAACTGCTTGTCCCCTTCTAGTGTGCAACTGCGACGTGGCCTTGAGTTTTCCCCATCACGGTTCTTGTCTCGTTTTTCTCTCTCTCTGTCCCGATCCCGGTCCTTGTCTTTATCCTTTTCTTTGTCGGCAGTCATGG
Full Trace Sequence: GAAACGGCTTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAACTGCTTGTCCCCTTCTAGTGTGCAACTGCGACGTGGCCTTGAGTTTTCCCCATCACGGTTCTTGTCTCGTTTTTCTCTCTCTCTGTCCCGATCCCGGTCCTTGTCTTTATCCTTTTCTTTGTCGGCAGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGCCGTCCATTGAAAAAAACAAGAAAAGAAAAACTGCGACTAGGCAACGGCAAGGGCGAAAGAAAGGAAAGGCCAGGTCGCAAAGGGGGGCGGTGGGGGACTCGGGGTAGGGGGGGAGGGCCTACGACGGGGAAAAACCATGGCCGGGCGTCGGAGTATGGAAATCGCGCAGCGCGCGGCCACTAGGGCAGAAACTAGACGAAGCAGCGGTGGGGAAGGCGAAGGGGGGTTTTTCTGGTTGGGTTAATGGTTTTTTTGGGTGATTCATGCCTGGGCGCCCAGCCTACAAGCGGGGTCACCCTGATCGCGGGTTGGTTTATAAAACAACCAACATTTACCCAACCAGCCATCTCTCTTAAAAAAAATGAAAAATTAATAAAGAAAGGGGGGCGGCCAGATACTCTCNCCACCTCCAAAATATTTGGGTGGGGTTGGCGCGGCGCGCCAANGCCCGGACACGTTGCTCCGCGCGGTGTGGGTGATTATGATGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAACTGCTTGTCCCCTTCT