ORFeome > rfc4 ORF1 – XORFeome v1.0

rfc4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rfc4
Gene ID: 955731
Gene Page ID: 955723
ORF Xenbase ID: 17293179

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129742
Original XGC clone length: 1092

Human orthology & disease relationships

NCBI Entrez ID: 5984
Ensembl gene IDs: ENSG00000163918
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 214150,216400,223100,259500,277700,278300,278780,601675

Library Location

Plate ID: GDExl11092
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ838958
dbEST ID: 79656660
Trimmed Sequence: ATGCAGGCTTTTCTAAAAGGAGGCACATCTATCGGCACCAAGCCAGTGAAAGATAAAGCATCAGCATCTGGCACAGGAAGCACCGGGGAAAGCAAGAAACAGAAACCCATTCCATGGGTGGAAAAATACCGACCCAAATGTGTAGATGAGGTTGCTTTTCAAGATGAAGTTGTTGCTGTGCTTAAAAAGTCACTGCAAGGTGCAGATCTTCCAAACTTGTTATTTTATGGCCCACCTGGCACCGGTAAAACATCAACTATTTTGGCAGCATCCAGGGAACTCTATGGGCCTGAATTGTTTCGGCAGCGAGTTTTGGAACTGAATGCATCTGACGAAAGGGGTATACAAGTGGTACGGGAAAAAGTAAAAAATTTTGCTCAGCTCACTGTTGGAGGGACCCGTTCTGATGGTAAACCATGTCCCCCTTTTAAGATTATAATTTTGGATGAAGCAGATTCTATGACATCAGCTGCACAGGCTGCTCTCCGGCGCACCATGGAAAAGGAGTCAAAAACAACTCGCTTTTGTCTCATATGTAACTACGTCAGCAGAATAATTGAACCTTTAACTTCTCGATGTTCCAAATTTCGTTTCAAACCCCTGGCTGATAAAATACAAACTCAGCGACTACTGAGTATATGTGAAAAAGAAAACGTACAAATCACAAATGAGGCAATAAAGTGTTTTGGTTGAATTGGCTGGAGGGAGACTTGCGAAAAACCATCAAAATCCCTTCAAAATGCTGCCAAGTTAAACTCCGAGAAAAGAAAAAAACAGAAAAAAATAATAAAAAAAAAAAAACTGGGGGGTTGTTTCCTAAGAAAAG
Full Trace Sequence: GGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGGCTTTTCTAAAAGGAGGCACATCTATCGGCACCAAGCCAGTGAAAGATAAAGCATCAGCATCTGGCACAGGAAGCACCGGGGAAAGCAAGAAACAGAAACCCATTCCATGGGTGGAAAAATACCGACCCAAATGTGTAGATGAGGTTGCTTTTCAAGATGAAGTTGTTGCTGTGCTTAAAAAGTCACTGCAAGGTGCAGATCTTCCAAACTTGTTATTTTATGGCCCACCTGGCACCGGTAAAACATCAACTATTTTGGCAGCATCCAGGGAACTCTATGGGCCTGAATTGTTTCGGCAGCGAGTTTTGGAACTGAATGCATCTGACGAAAGGGGTATACAAGTGGTACGGGAAAAAGTAAAAAATTTTGCTCAGCTCACTGTTGGAGGGACCCGTTCTGATGGTAAACCATGTCCCCCTTTTAAGATTATAATTTTGGATGAAGCAGATTCTATGACATCAGCTGCACAGGCTGCTCTCCGGCGCACCATGGAAAAGGAGTCAAAAACAACTCGCTTTTGTCTCATATGTAACTACGTCAGCAGAATAATTGAACCTTTAACTTCTCGATGTTCCAAATTTCGTTTCAAACCCCTGGCTGATAAAATACAAACTCAGCGACTACTGAGTATATGTGAAAAAGAAAACGTACAAATCACAAATGAGGCAATAAAGTGTTTTGGTTGAATTGGCTGGAGGGAGACTTGCGAAAAACCATCAAAATCCCTTCAAAATGCTGCCAAGTTAAACTCCGAGAAAAGAAAAAAACAGAAAAAAATAATAAAAAAAAAAAAACTGGGGGGTTGTTTCCTAAGAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGGCTTTTCTAAAAGGAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838957
dbEST ID: 79656659
Trimmed Sequence: GCTGTTTTGAGTCATTTGTTGCATAACAACTGCAAAAAGGCCAAGCATTTGCAAGTATTCATCAGCTCCATCGGTCAAACATTTGTCCACGTCTGCAAGTTTTTCTGTAATAAACGCTTTCTGCTTGTCAGTTAGGTCCCCTCTCTCTAATATTACATCATGGAGCTGGTTTACAAGCTGTGTGGCTGCATGTCCATTGTTTATAAGATCTTTGACAAAATTTTCCAACTTTTCAAAGGAACCACTTTGACAGACTACTAGCACAGAATCAAGTGTTTCTTTAGGAACTACCCCAGCTATTTCTGTCACTATTTCTTCTGTTATTTCCTTTCCTCGAGTTAACCTTGCAGCACTCTGAAGGAATGTGATGGCTTTTCGCAAGTCTCCTTCAGACACTTCAACCAAACAACTTATTGCCTCATTTGTGATTTGTACGTTTTCTTTTTCACATATACTCAGTAGTCGCTGAGTTTGTATTTTATCAGCCAGGGGTTTGAAACGAAATTTGGAACATCGAGAAGTTAAAGGTTCAATTATTCTGCTGACGTAGTTACATATGAGACAAAAACAAGTTGTTTTTGACTCCTTTTCCATGGTGCGCCGGAGAGCAACCGGTGCACCTAATGTCCAAGAAACTGCCTTCTCCCAAATTTATAATCTTAAAAAGGGGAACATGGGTTTACCAATCAAAAAACGTCTCCCTCCCCACCGGTAACCCTGAAACAAAAATATTTTTAACATTTTTTTCCCCTTACCCCCA
Full Trace Sequence: GGGCAAACAGGCTATGACCATGTAATACGACTCACTATANGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGTTTTGAGTCATTTGTTGCATAACAACTGCAAAAAGGCCAAGCATTTGCAAGTATTCATCAGCTCCATCGGTCAAACATTTGTCCACGTCTGCAAGTTTTTCTGTAATAAACGCTTTCTGCTTGTCAGTTAGGTCCCCTCTCTCTAATATTACATCATGGAGCTGGTTTACAAGCTGTGTGGCTGCATGTCCATTGTTTATAAGATCTTTGACAAAATTTTCCAACTTTTCAAAGGAACCACTTTGACAGACTACTAGCACAGAATCAAGTGTTTCTTTAGGAACTACCCCAGCTATTTCTGTCACTATTTCTTCTGTTATTTCCTTTCCTCGAGTTAACCTTGCAGCACTCTGAAGGAATGTGATGGCTTTTCGCAAGTCTCCTTCAGACACTTCAACCAAACAACTTATTGCCTCATTTGTGATTTGTACGTTTTCTTTTTCACATATACTCAGTAGTCGCTGAGTTTGTATTTTATCAGCCAGGGGTTTGAAACGAAATTTGGAACATCGAGAAGTTAAAGGTTCAATTATTCTGCTGACGTAGTTACATATGAGACAAAAACAAGTTGTTTTTGACTCCTTTTCCATGGTGCGCCGGAGAGCAACCGGTGCACCTAATGTCCAAGAAACTGCCTTCTCCCAAATTTATAATCTTAAAAAGGGGAACATGGGTTTACCAATCAAAAAACGTCTCCCTCCCCACCGGTAACCCTGAAACAAAAATATTTTTAACATTTTTTTCCCCTTACCCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGTTTTGAGTCATTTGTTGCAT