ORFeome > rgma ORF1 – XORFeome v1.0

rgma ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rgma
Gene ID: 876355
Gene Page ID: 876345
ORF Xenbase ID: 17293233

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045008
Original XGC clone length: 1194

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ824010
dbEST ID: 79641712
Trimmed Sequence: ATGGGTATGGGGAGAGGGGCAGGACCCAAAGCCCTGGGATTCTTCAAAATCCTCACTGTCTTCTTGTGCACTTTTCATACAGTGAGCTCATCGTGCAAGATTTTGAAGTGCACTGCTGACTACTTGCAAGCGACTTCCAACCCGCACCATCACACAGGAGCTGAGGACACGGTGGAGATCTGCACGGCATTACGCACCTACGCCCACTGCAGCCGACGCACAGCACGCACTTGCAGAGGAGACCTGGCTTACCATTCAACTGTCCATGGCATCGATGACCTCATGAGCCACCATAACTGCTCCAAAGATGGCCCCACCTCTCAGCCACGTGTGCGCATCTTGCCCCCAGGAGACAGCCAAGAGAGGTCGGACAGCCCTGAAATATGTCATTATGAAAAAAGCTTCCACAGACCCTCTGCCCTTCCAAACTACACCCACTGTGGCCTCTTTGGAGACCCCCATCTTAGGACGTTTTCAGACACTTTTCAGACCTGCAAAATCCAAGGCGCTTGGCCCCTCATAGACAATAATTACTTGAACGTGCAGGTTACCAACACTCCTGTGCTTCCAGGATCAACTGCCACAGCCACCAGCAAGTTGACTATCATTTTCAAGAACTTCCAGGAGTGTGTAGACCAGAAAGTGTACCAGGCTGAGATGGATGAACTTCCTGCAGCTTTCATTGATGGTTCGAAAAATGGTGGAGAACAGAGTGGAGCCAACAGCTTTGAGATCATTTAAGAAAAGTGTCCGGGGCAGCAAAATGGAAATTCCAGGGCCAGATACATCGGCCC
Full Trace Sequence: AATTGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTATGGGGAGAGGGGCAGGACCCAAAGCCCTGGGATTCTTCAAAATCCTCACTGTCTTCTTGTGCACTTTTCATACAGTGAGCTCATCGTGCAAGATTTTGAAGTGCACTGCTGACTACTTGCAAGCGACTTCCAACCCGCACCATCACACAGGAGCTGAGGACACGGTGGAGATCTGCACGGCATTACGCACCTACGCCCACTGCAGCCGACGCACAGCACGCACTTGCAGAGGAGACCTGGCTTACCATTCAACTGTCCATGGCATCGATGACCTCATGAGCCACCATAACTGCTCCAAAGATGGCCCCACCTCTCAGCCACGTGTGCGCATCTTGCCCCCAGGAGACAGCCAAGAGAGGTCGGACAGCCCTGAAATATGTCATTATGAAAAAAGCTTCCACAGACCCTCTGCCCTTCCAAACTACACCCACTGTGGCCTCTTTGGAGACCCCCATCTTAGGACGTTTTCAGACACTTTTCAGACCTGCAAAATCCAAGGCGCTTGGCCCCTCATAGACAATAATTACTTGAACGTGCAGGTTACCAACACTCCTGTGCTTCCAGGATCAACTGCCACAGCCACCAGCAAGTTGACTATCATTTTCAAGAACTTCCAGGAGTGTGTAGACCAGAAAGTGTACCAGGCTGAGATGGATGAACTTCCTGCAGCTTTCATTGATGGTTCGAAAAATGGTGGAGAACAGAGTGGAGCCAACAGCTTTGAGATCATTTAAGAAAAGTGTCCGGGGCAGCAAAATGGAAATTCCAGGGCCAGATACATCGGCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTATGGGGAGAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829318
dbEST ID: 79647020
Trimmed Sequence: TGGCCTTTCAAACAAATGGACTTTGTTCTTGTTGGAGTGTAATAGCTTCACATCCTCGAAGGCGTAATAAGCAGCTAATGTGAAATTCACGTCCCCTGTGGTGAGGAGGTCAAAGACGCAAGACTGGAAGTAGAGGTCCTTCACTGGCAGCTTCTCCTTGCACTTGGCTTCTGCCGTTTGGGGGGTGAAGGAAGCAGCACTGGAGGCACTGGTTAGCCTCTTAAGACCAGTCTCTGGGGCTTGCAAGTGAAAGTTTCGAAAGTCAATCTGCTGGTTTTGAGGGCAACCGTGGAGGCACAAGTAAAGTCCCTGGTTATCCTTGTCCTCCACAGCATTCACAACCTCCTCTGGCATCCGGACTGCGAAGGTCAAGTAGTGACCCACCTGACGGACCACAATTGTGGTGCCGATGTACTTGGCCTGGATCTCAATGTGCTGCCCGGACACTTTCTCAATGATTCTCAAGCTGTTGGCTCCACTCTTGTCTCCACCATTTTTCGAACCATCAATGAAAGCTGCAGGAAGTTCATCCATCTCAGCCTGGTACACTTTCTGGTCTACACACTCCTGGAAGTTCTTGAAAATGATAGTCAACTTGCTGGTGGCTGTGGCAGTTGATCCTGGAAACACAGGAGTGTTGGTAACCTGCACGTTCAAGTAATTATTGTCTATGAGGGGCCAAGCGCCTTGGAATTTTGCAGGGTCTGAAAAGTTGTCTGAAAAACTTCCCAAAAAAAGGGGGGTTCTCCCAAAAAAGGCCACAAGG
Full Trace Sequence: GCCGTGTAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGCCTTTCAAACAAATGGACTTTGTTCTTGTTGGAGTGTAATAGCTTCACATCCTCGAAGGCGTAATAAGCAGCTAATGTGAAATTCACGTCCCCTGTGGTGAGGAGGTCAAAGACGCAAGACTGGAAGTAGAGGTCCTTCACTGGCAGCTTCTCCTTGCACTTGGCTTCTGCCGTTTGGGGGGTGAAGGAAGCAGCACTGGAGGCACTGGTTAGCCTCTTAAGACCAGTCTCTGGGGCTTGCAAGTGAAAGTTTCGAAAGTCAATCTGCTGGTTTTGAGGGCAACCGTGGAGGCACAAGTAAAGTCCCTGGTTATCCTTGTCCTCCACAGCATTCACAACCTCCTCTGGCATCCGGACTGCGAAGGTCAAGTAGTGACCCACCTGACGGACCACAATTGTGGTGCCGATGTACTTGGCCTGGATCTCAATGTGCTGCCCGGACACTTTCTCAATGATTCTCAAGCTGTTGGCTCCACTCTTGTCTCCACCATTTTTCGAACCATCAATGAAAGCTGCAGGAAGTTCATCCATCTCAGCCTGGTACACTTTCTGGTCTACACACTCCTGGAAGTTCTTGAAAATGATAGTCAACTTGCTGGTGGCTGTGGCAGTTGATCCTGGAAACACAGGAGTGTTGGTAACCTGCACGTTCAAGTAATTATTGTCTATGAGGGGCCAAGCGCCTTGGAATTTTGCAGGGTCTGAAAAGTTGTCTGAAAAACTTCCCAAAAAAAGGGGGGTTCTCCCAAAAAAGGCCACAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGCCTTTCAAACAAATGGACT