ORFeome > rgs1 ORF1 – XORFeome v1.0

rgs1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rgs1
Gene ID: 968769
Gene Page ID: 968764
ORF Xenbase ID: 17293251

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC078517
Original XGC clone length: 387

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ839718
dbEST ID: 79657420
Trimmed Sequence: ATGTCTCTGGAAAAACTCCTTGTAAGCGAAGAAGGACAGGCTGTCTTCAAAGAGTTTTTGAAGTCTGAGTTCAGCGAGGAAAACATTGAGTTCTGGCTGGCCTGTGAAGACTACAAGGCTAACAACGATTCAGAGGAATTGCGTTGCAAAGCTAACGTTATATACCAAGAATTCATACAACCGAATGCATACAAACAAATTAATATTGATTTTTCTACCAGAAATTCAGTTACAAAAGATCTCCTTGAACCCACAATAACAACATTCAATGACGCTCAGAAAATGATATTCGTTCTCATGGAAAGAGACTCATACCCAAGATTTCTAAAATCAGAAATATTTTTCAGACTTGCAGAAAGGCACCATGGAAATAATGTGAGAGGATT
Full Trace Sequence: GGGCTCCTATAATTGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTCTGGAAAAACTCCTTGTAAGCGAAGAAGGACAGGCTGTCTTCAAAGAGTTTTTGAAGTCTGAGTTCAGCGAGGAAAACATTGAGTTCTGGCTGGCCTGTGAAGACTACAAGGCTAACAACGATTCAGAGGAATTGCGTTGCAAAGCTAACGTTATATACCAAGAATTCATACAACCGAATGCATACAAACAAATTAATATTGATTTTTCTACCAGAAATTCAGTTACAAAAGATCTCCTTGAACCCACAATAACAACATTCAATGACGCTCAGAAAATGATATTCGTTCTCATGGAAAGAGACTCATACCCAAGATTTCTAAAATCAGAAATATTTTTCAGACTTGCAGAAAGGCACCATGGAAATAATGTGAGAGGATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTAAAAAAAACACTAACCCGTGTCTCAAATCTACTGATGTTACACAAAGAAAAGGAAATAGCTCAATCAGGGCGGGCCCCGATAGGGGGGGGTCCTAAAAAAAAAAAAAATAAGGAAAAACACCCCGAATAACACCAAGCCCCCCTGGCACACCTAGGAAGGCAGGGAATAGGCCCCGCCAAGGGGGCCAAACACTTCCCAAAGAGGCCGGGGGGAGGGCCAAAAAAAAACCTTTTTTATATTTTTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCTGGAAAAACTCCTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839717
dbEST ID: 79657419
Trimmed Sequence: TCCTCTCACATTATTTCCATGGTGCCTTTCTGCAAGTCTGAAAAATATTTCTGATTTTAGAAATCTTGGGTATGAGTCTCTTTCCATGAGAACGAATATCATTTTCTGAGCGTCATTGAATGTTGTTATTGTGGGTTCAAGGAGATCTTTTGTAACTGAATTTCTGGTAGAAAAATCAATATTAATTTGTTTGTATGCATTCGGTTGTATGAATTCTTGGTATATAACGTTAGCTTTGCAACGCAATTCCTCTGAATCGTTGTTAGCCTTGTAGTCTTCACAGGCCAGCCAGAACTCAATGTTTTCCTCGCTGAACTCAAACTTCAAAAACTCTTTGAAGACAGCCTGTCCTTCTTCGCTTACAAGGAGTTTTTCCAGAGACATGG
Full Trace Sequence: GGAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCTCTCACATTATTTCCATGGTGCCTTTCTGCAAGTCTGAAAAATATTTCTGATTTTAGAAATCTTGGGTATGAGTCTCTTTCCATGAGAACGAATATCATTTTCTGAGCGTCATTGAATGTTGTTATTGTGGGTTCAAGGAGATCTTTTGTAACTGAATTTCTGGTAGAAAAATCAATATTAATTTGTTTGTATGCATTCGGTTGTATGAATTCTTGGTATATAACGTTAGCTTTGCAACGCAATTCCTCTGAATCGTTGTTAGCCTTGTAGTCTTCACAGGCCAGCCAGAACTCAATGTTTTCCTCGCTGAACTCAAACTTCAAAAACTCTTTGAAGACAGCCTGTCCTTCTTCGCTTACAAGGAGTTTTTCCAGAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCAAAAAAAAAAAAAACAATCGTTATATAACATCTAGCACTGACAACGGCAGGAAATGACTAAACTCAAGTGCTACCAGGGAAACGGGAAAATCAATCAAGGGTGTTATGGAGAAACAAACCAGGGGAGTAACCCAGTTGCGTCTAAACAAATAAAAAAAAAAAAAAGACCCCCCGGCACGGGGCCAAAACACTGACAAACCCCTCCGGGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCTCTCACATTATTTCCATGGT