ORFeome > rhbg ORF1 – XORFeome v1.0

rhbg ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rhbg
Gene ID: 6255430
Gene Page ID: 1009285
ORF Xenbase ID: 17293341

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC059979
Original XGC clone length: 1362

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ824480
dbEST ID: 79642182
Trimmed Sequence: ATGCGGATTAAGTTGCCCTTATTCTGCCTCATCCTCCAATTCATCACTATCATCCTCTTCGCTGTCTTCGTGAGGTACGACCACGAGTCCGATGCCAGGGGCTGGCACGATGAACTGAAGAACCACAGCACTGCCAACGCAGACAACGACTTCTACTTTCGCTATCCAAGCTTCCAAGATGTCCACGTGATGATCTTCATTGGCTTTGGATTTTTGATGACATTCCTCAAGCGCTATGGTTTCAGCAGTGTGGCCTTTAACTTCCTCATAGCAGCTTTCGGCCTCCAGTGGTCAACCCTCATCCAAGGCTTTTTCCATGGTTTTCATGATGGCAAGATTCATGTTGGCATAGAGAGCATGATTAATGCTGATTTCTGCACTGGAGCCGTCCTCATCTCCTTCGGGGCAGTCCTAGGGAAGACCAGCCCAGTCCAACTGATCGTAATGACCTTGATTGAAGTGACCCTATTCGGTATCAATGAATACATCATTCTGAACATTGTCGGGGCTAAGGATGCTGGTGGATCAATGACCATACACACTTTTGGAGCCTACTTCGGTCTGATTGTTTCCAGAGTTCTCTACAGAGCGGACCTGGATAAGAGTCGGCAGAGGGAAGGATCTGTCTATCACTCCGACCTCTTCGCTATGATTGGGACTATCTACCTTTGGATGTTCTGGCCCAGCTTCAACTCCGCCGTCACAGCTCATGGAGATGACCAACACCGCACTGTACTGAACACGTACTACTCACTTGCTGCCTGTACT
Full Trace Sequence: ACAAAAATGATTATTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGGATTAAGTTGCCCTTATTCTGCCTCATCCTCCAATTCATCACTATCATCCTCTTCGCTGTCTTCGTGAGGTACGACCACGAGTCCGATGCCAGGGGCTGGCACGATGAACTGAAGAACCACAGCACTGCCAACGCAGACAACGACTTCTACTTTCGCTATCCAAGCTTCCAAGATGTCCACGTGATGATCTTCATTGGCTTTGGATTTTTGATGACATTCCTCAAGCGCTATGGTTTCAGCAGTGTGGCCTTTAACTTCCTCATAGCAGCTTTCGGCCTCCAGTGGTCAACCCTCATCCAAGGCTTTTTCCATGGTTTTCATGATGGCAAGATTCATGTTGGCATAGAGAGCATGATTAATGCTGATTTCTGCACTGGAGCCGTCCTCATCTCCTTCGGGGCAGTCCTAGGGAAGACCAGCCCAGTCCAACTGATCGTAATGACCTTGATTGAAGTGACCCTATTCGGTATCAATGAATACATCATTCTGAACATTGTCGGGGCTAAGGATGCTGGTGGATCAATGACCATACACACTTTTGGAGCCTACTTCGGTCTGATTGTTTCCAGAGTTCTCTACAGAGCGGACCTGGATAAGAGTCGGCAGAGGGAAGGATCTGTCTATCACTCCGACCTCTTCGCTATGATTGGGACTATCTACCTTTGGATGTTCTGGCCCAGCTTCAACTCCGCCGTCACAGCTCATGGAGATGACCAACACCGCACTGTACTGAACACGTACTACTCACTTGCTGCCTGTACT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGGATTAAGTTGCCCTTAT

Sequences - 3ʹ (reverse) EST

Accession: JZ829834
dbEST ID: 79647536
Trimmed Sequence: CGCTTGCGTATCCGGGTCCTCGTTGTTAACAACAACGGTCAGTTGTTGGTGCCCCTCTCCTCCTGGTACCTCCCAGTATACTGCATCTTCAAAGCACTCGGCGTCAGACGGTGTTCCAAAGAGCGGCAACTTCAATATGAACCCTACAACAGTTCCTCCAACGATGGCAAATCCCAAAGCTACCAGCAGTGCCAGGAACTGGTAGAGAGATTGTTGCTTGGCTGTGCGGCTGCCATCGAATATCATTGGGAAGACATCGTCCATCCCATCACCATAGATGTCTGCCGTTGCAAAGAGCGCCACAATAGCTCCAATGACTGCACCCAAGATTCCTGGCATTCCATGGAGGTTGTGCACCCCACATGTATCTTGAATCTTCAGCTTGGAGTCTAGAACTGGAGTTAAGTATTTGTATCCAAGGACAGAGACTATGCCAGCCAGTGTCCCTGCAATCATGGCTCCAAAGGGGGTCAGCATCATTTCACCGGACGTTCCAACTGCAACACCCCCTGCTAGGGCAGCATTCTGGATGTGAACCATGTCCAGCTTTCCTTCTCCATTAAGCAGAGCTGAGAAACCAAACGTGGCCNANGTACAGGCAGCAAGTGAGTAGTACGTGTTCAGTACAAGTGCGGTGTTGGTCATCTCCATGAGCTGTTGACGGCCGGAGTTGAAGCTGGGGCCAGAACATCCCAAAGGGAAGATAGTCCCAATTCCTAACGAAAAAAAGGCGGAAATGGAAAAAAAAGAAACCCTTCCCCTCCTGC
Full Trace Sequence: TGACGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGCTTGCGTATCCGGGTCCTCGTTGTTAACAACAACGGTCAGTTGTTGGTGCCCCTCTCCTCCTGGTACCTCCCAGTATACTGCATCTTCAAAGCACTCGGCGTCAGACGGTGTTCCAAAGAGCGGCAACTTCAATATGAACCCTACAACAGTTCCTCCAACGATGGCAAATCCCAAAGCTACCAGCAGTGCCAGGAACTGGTAGAGAGATTGTTGCTTGGCTGTGCGGCTGCCATCGAATATCATTGGGAAGACATCGTCCATCCCATCACCATAGATGTCTGCCGTTGCAAAGAGCGCCACAATAGCTCCAATGACTGCACCCAAGATTCCTGGCATTCCATGGAGGTTGTGCACCCCACATGTATCTTGAATCTTCAGCTTGGAGTCTAGAACTGGAGTTAAGTATTTGTATCCAAGGACAGAGACTATGCCAGCCAGTGTCCCTGCAATCATGGCTCCAAAGGGGGTCAGCATCATTTCACCGGACGTTCCAACTGCAACACCCCCTGCTAGGGCAGCATTCTGGATGTGAACCATGTCCAGCTTTCCTTCTCCATTAAGCAGAGCTGAGAAACCAAACGTGGCCNANGTACAGGCAGCAAGTGAGTAGTACGTGTTCAGTACAAGTGCGGTGTTGGTCATCTCCATGAGCTGTTGACGGCCGGAGTTGAAGCTGGGGCCAGAACATCCCAAAGGGAAGATAGTCCCAATTCCTAACGAAAAAAAGGCGGAAATGGAAAAAAAAGAAACCCTTCCCCTCCTGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGCTTGCGTATCCGGGT