ORFeome > rho ORF1 – XORFeome v1.0

rho ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rho
Gene ID: 966893
Gene Page ID: 966886
ORF Xenbase ID: 17293371

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054145
Original XGC clone length: 1065

Human orthology & disease relationships

NCBI Entrez ID: 6010
Ensembl gene IDs: ENSG00000163914
Directly associated (OMIM) disease MIM numbers: 136880,610445,613731
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ839467
dbEST ID: 79657169
Trimmed Sequence: ATGAACGGAACAGAGGGTCCCAATTTTTATATCCCCATGTCCAACAAAACTGGGGTGGTACGAAGCCCATTCGATTACCCTCAGTATTACTTAGCAGAGCCATGGCAATATTCAGCACTGGCTGCTTACATGTTCCTGCTCATCCTGCTTGGGTTACCAATCAACTTCATGACCTTGTTTGTTACCATCCAGCACAAGAAACTCAGAACACCCCTAAACTACATCCTGCTGAACCTGGTATTTGCCAATCACTTCATGGTCCTGTGTGGGTTCACGGTGACAATGTACACCTCAATGCACGGCTACTTCATCTTTGGCCAAACTGGTTGCTACATTGAAGGCTTCTTTGCTACACTTGGTGGTGAAGTGGCCCTCTGGTCACTGGTAGTATTGGCCGTTGAAAGATATATGGTGGTCTGCAAGCCCATGGCCAACTTCCGATTCGGGGAGAACCATGCTATCATGGGTGTAGCCTTCACATGGATCATGGCTTTGTCTTGTGCTGCTCCTCCTCTATTTGGATGGTCCAGATACATCCCAGAGGGAATGCAATGCTCATGCGGAGTAGACTACTACACACTGAAGCCTGAGGTCAACAATGAATCCTTTGTTATCTACATGTTCGTTGTCCACTTCACCATTCCCCTGATTGTCATCTTCTTCTGCTATGGCCGCCTGCTCTGCACTGGTCAAAAAGCTGCAACCCAACAACAGGAATCTGCAACCAACCCAAAAGCTTAAAAAAAAGTCACCAAAAAGGGTTGGTTACCAGGGTTCGTTTCCTTCCCGAATCCTGTTGGGTGCCCCAATGCCCCAGTGGGGCATTTCCCC
Full Trace Sequence: CTGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACGGAACAGAGGGTCCCAATTTTTATATCCCCATGTCCAACAAAACTGGGGTGGTACGAAGCCCATTCGATTACCCTCAGTATTACTTAGCAGAGCCATGGCAATATTCAGCACTGGCTGCTTACATGTTCCTGCTCATCCTGCTTGGGTTACCAATCAACTTCATGACCTTGTTTGTTACCATCCAGCACAAGAAACTCAGAACACCCCTAAACTACATCCTGCTGAACCTGGTATTTGCCAATCACTTCATGGTCCTGTGTGGGTTCACGGTGACAATGTACACCTCAATGCACGGCTACTTCATCTTTGGCCAAACTGGTTGCTACATTGAAGGCTTCTTTGCTACACTTGGTGGTGAAGTGGCCCTCTGGTCACTGGTAGTATTGGCCGTTGAAAGATATATGGTGGTCTGCAAGCCCATGGCCAACTTCCGATTCGGGGAGAACCATGCTATCATGGGTGTAGCCTTCACATGGATCATGGCTTTGTCTTGTGCTGCTCCTCCTCTATTTGGATGGTCCAGATACATCCCAGAGGGAATGCAATGCTCATGCGGAGTAGACTACTACACACTGAAGCCTGAGGTCAACAATGAATCCTTTGTTATCTACATGTTCGTTGTCCACTTCACCATTCCCCTGATTGTCATCTTCTTCTGCTATGGCCGCCTGCTCTGCACTGGTCAAAAAGCTGCAACCCAACAACAGGAATCTGCAACCAACCCAAAAGCTTAAAAAAAAGTCACCAAAAAGGGTTGGTTACCAGGGTTCGTTTCCTTCCCGAATCCTGTTGGGTGCCCCAATGCCCCAGTGGGGCATTTCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACGGAACAGAGGGTCCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839466
dbEST ID: 79657168
Trimmed Sequence: TGCAGGAGACACCTGGCTGGAAGAGACAGAAGAAGCTTCTGTCTTGGAGGTGGCTGCAGAGGAGCCATCTTCATCACCGAATGGATTCTTTCCACAGCACAGGGTGGTGATCAAGCAGTTACGGAACTGTTTGTTCAAAACAATGTAGATGACAGGATTGTAGATAGCAGAGCTCTTGGCAAAGAAAGCTGGGACAGTCATGAAGACTGGGCCAAAGTCGGAGCCCTGGTGGGTGAAGATGTAGAATGCCACATAGGCATAGGGCACCCAACAGATCAGGAAGAAAACGACCATGATAACAACCATTCTGGTGACCTCTTTCTCAGCCTTCTGGGTGGTAGCAGATTCCTGTTGCTGGGCTGCAGCCTCTTTGACAGTGCAGAGCAGGCGGCCATAGCAGAAGAAGATGACAATCAGGGGAATGGTGAAGTGGACAACGAACATGTAGATTACAAAGGATTCATTGTTGACCTCACGCTTCGGTGTGTAATAATCTACTCCGCATGAGCATTGCATTCCCTCTCGGATGTATCTGGACCATCCCAATAAAGGAAGAGCAGCAGCAAAACAAACCATGATCCATGTGAAGGCTACACCCATGATAGCATGGGTCTTCCCGGATCCAAATTTGGCCTGGGCTTGCAAAACCACCAAAATCTTTCCCCCGCCCAATCTCACCATGGAACCAAGGGCCACCTTGCCGCCCGGGGTTTAACAAAAAACCCTTCAATGTTACAGGCCTATTTTGGGCCCAAAAATTAAAAAAC
Full Trace Sequence: GAACAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCAGGAGACACCTGGCTGGAAGAGACAGAAGAAGCTTCTGTCTTGGAGGTGGCTGCAGAGGAGCCATCTTCATCACCGAATGGATTCTTTCCACAGCACAGGGTGGTGATCAAGCAGTTACGGAACTGTTTGTTCAAAACAATGTAGATGACAGGATTGTAGATAGCAGAGCTCTTGGCAAAGAAAGCTGGGACAGTCATGAAGACTGGGCCAAAGTCGGAGCCCTGGTGGGTGAAGATGTAGAATGCCACATAGGCATAGGGCACCCAACAGATCAGGAAGAAAACGACCATGATAACAACCATTCTGGTGACCTCTTTCTCAGCCTTCTGGGTGGTAGCAGATTCCTGTTGCTGGGCTGCAGCCTCTTTGACAGTGCAGAGCAGGCGGCCATAGCAGAAGAAGATGACAATCAGGGGAATGGTGAAGTGGACAACGAACATGTAGATTACAAAGGATTCATTGTTGACCTCACGCTTCGGTGTGTAATAATCTACTCCGCATGAGCATTGCATTCCCTCTCGGATGTATCTGGACCATCCCAATAAAGGAAGAGCAGCAGCAAAACAAACCATGATCCATGTGAAGGCTACACCCATGATAGCATGGGTCTTCCCGGATCCAAATTTGGCCTGGGCTTGCAAAACCACCAAAATCTTTCCCCCGCCCAATCTCACCATGGAACCAAGGGCCACCTTGCCGCCCGGGGTTTAACAAAAAACCCTTCAATGTTACAGGCCTATTTTGGGCCCAAAAATTAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCAGGAGACACCTGGCTGGA