ORFeome > rhoa ORF1 – XORFeome v1.0

rhoa ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rhoa
Gene ID: 865846
Gene Page ID: 489221
ORF Xenbase ID: 17293377

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053772
Original XGC clone length: 582

Human orthology & disease relationships

NCBI Entrez ID: 387
Ensembl gene IDs: ENSG00000067560
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 124900,125800,131300,153640,153650,154705,155100,161800,173900,182290,215600,300436,300511,300558,301000,313900,600652,603278,603622,605249,607841,608203,608751,609192,609322,609942

Library Location

Plate ID: GDExl11001
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ839142
dbEST ID: 79656844
Trimmed Sequence: ATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTT
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAACCTTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCCAAATAAAATCATTATTTGGCCATCCCGCTGATATCCCCTAATGTGAAGTCGTATTACAGGGTCATTAACTGGAAATCAAGAAAAAATCCGGGGCCCGGGTCTCAAAAATCCTCTTAAATTTTAAAAAAGGANGGGNA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCCATTCGTAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839141
dbEST ID: 79656843
Trimmed Sequence: GATGAGAAGGCACGTGGTTTTCTTCTTGCCACGCCTAGCTTGCAGGGCTGCCCGTGTAGCCAGCTCAAACACTTCCCTCACGCCATCTTTCGTTTTTGCAGAGCATTCCATGTAGCCGTAGGCGGAGATACGGTTTGCCATGTCACGACCTTCTTCGGGCTTCACAGGCTCCTGTTTCATTTTGGTGAGCTCCCTACGAGTGTGTTCATCATTACGCAGATCCTTCTTGTTTCCAACTAAAATAATGGGCACATTGGGGCAGAAATGTTTCACCTCCGGGGTCCATTTCTCAGGTATGTTTTCTAAACTGTCGGGGCTATCAATGGAAAAGCACATTAATATAACATCAGTGTCTGGATAGGACAGAGGTCGCAGTCTGTCATAATCTTCTTGACCAGCTGTATCCCATAGGGCCAACTCAACCTGCTTGCCATCCACTTCTATGTCTGCCACATAGTTCTCAAAAACTGTTGGGACATACACTTCTGGAAACTGGTCTTTACTGAAACAATCAGAAGGCAGGTTTTCCCCCCTGCACCATCTCCCACAATTACAAGCTTCTTACAAAGGGCTGCCATGG
Full Trace Sequence: GGCGGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGAGAAGGCACGTGGTTTTCTTCTTGCCACGCCTAGCTTGCAGGGCTGCCCGTGTAGCCAGCTCAAACACTTCCCTCACGCCATCTTTCGTTTTTGCAGAGCATTCCATGTAGCCGTAGGCGGAGATACGGTTTGCCATGTCACGACCTTCTTCGGGCTTCACAGGCTCCTGTTTCATTTTGGTGAGCTCCCTACGAGTGTGTTCATCATTACGCAGATCCTTCTTGTTTCCAACTAAAATAATGGGCACATTGGGGCAGAAATGTTTCACCTCCGGGGTCCATTTCTCAGGTATGTTTTCTAAACTGTCGGGGCTATCAATGGAAAAGCACATTAATATAACATCAGTGTCTGGATAGGACAGAGGTCGCAGTCTGTCATAATCTTCTTGACCAGCTGTATCCCATAGGGCCAACTCAACCTGCTTGCCATCCACTTCTATGTCTGCCACATAGTTCTCAAAAACTGTTGGGACATACACTTCTGGAAACTGGTCTTTACTGAAACAATCAGAAGGCAGGTTTTCCCCCCTGCACCATCTCCCACAATTACAAGCTTCTTACAAAGGGCTGCCATGGTGCCAACTTTTTTGTACAAAATTGGGATTAAAAAAAAAACATTGCTCATCTCATTTGTTGCCAACAAACAGGTCACTATCCATCAAAAAAAAATTCTTTATTTTGGGGCCCGAACTTTAAAACGGGGACGGGCGGTTTACAAAGGCTCATGTAATGGGGGGAGGTCCCCCCGACCCCCCCCCCCGGCCCCGGGTTCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGAGAAGGCACGTGG