ORFeome > rhot1 ORF1 – XORFeome v1.0

rhot1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rhot1
Gene ID: 866397
Gene Page ID: 494892
ORF Xenbase ID: 17293437

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124984
Original XGC clone length: 1857

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ837569
dbEST ID: 79655271
Trimmed Sequence: ATGAAGAAGGATGTGAGAATCCTGCTGGTGGGAGAACCCAGGGTTGGGAAGACCTCTCTTGTTATGTCCCTGGTCAGCGAGGAGTTCCCAGAGGAGGTTCCTGCTCGGGCAGAGGAGATTACAATCCCTGGAGATGTCACCCCTGAAAGAGTCCCAACACACATAGTGGATTATTCTGAAGCAGAACAGACAGATGACCAGCTGTACCTGGAGATATCGCGAGCCAATGTAATCTGCATTGTATACGCTGTAAATAACAAGAACTCTATCGATAAGGTCACCAATCACTGGATCCCTCTTATTAATGAACGAACAGACAAAGACAACAGGGTTCCACTCATTCTGGTGGGGAACAAGTCTGACCTGTTGGATTACAGCAGCTTGGAAACCATCCTGCCCATAATGAACCAATATTCAGAGATAGAAACATGTGTAGAGTGTTCAGCCAAAAACCTGAAAAACATATCAGAGCTTTTCTACTATGCTCAGAAAGCTGTTCTGCACCCCACCGGGCCCCTGTACTGCCCAGAAGAGAAAGAGCTGAAGCCAGCCTGTGTGAGAGCCCTGACACGCATCTTTAAGATATCAGACATGGATAATGACAGAATTTTAAACGATGCTGAACTTAACTTTTTCCAGAGAATATGCTTTCACATACCACTGGCACCACAAGGCCCTGGAGGACGTCAAGAATGTTTTGGCAAAGAATGTACACCAATGGTGTGGTCTGGCATTGGCCTGACTTTTTAAAAGGTTTTTCTGTTTTCTTCCCCACCCTCC
Full Trace Sequence: CGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGAAGGATGTGAGAATCCTGCTGGTGGGAGAACCCAGGGTTGGGAAGACCTCTCTTGTTATGTCCCTGGTCAGCGAGGAGTTCCCAGAGGAGGTTCCTGCTCGGGCAGAGGAGATTACAATCCCTGGAGATGTCACCCCTGAAAGAGTCCCAACACACATAGTGGATTATTCTGAAGCAGAACAGACAGATGACCAGCTGTACCTGGAGATATCGCGAGCCAATGTAATCTGCATTGTATACGCTGTAAATAACAAGAACTCTATCGATAAGGTCACCAATCACTGGATCCCTCTTATTAATGAACGAACAGACAAAGACAACAGGGTTCCACTCATTCTGGTGGGGAACAAGTCTGACCTGTTGGATTACAGCAGCTTGGAAACCATCCTGCCCATAATGAACCAATATTCAGAGATAGAAACATGTGTAGAGTGTTCAGCCAAAAACCTGAAAAACATATCAGAGCTTTTCTACTATGCTCAGAAAGCTGTTCTGCACCCCACCGGGCCCCTGTACTGCCCAGAAGAGAAAGAGCTGAAGCCAGCCTGTGTGAGAGCCCTGACACGCATCTTTAAGATATCAGACATGGATAATGACAGAATTTTAAACGATGCTGAACTTAACTTTTTCCAGAGAATATGCTTTCACATACCACTGGCACCACAAGGCCCTGGAGGACGTCAAGAATGTTTTGGCAAAGAATGTACACCAATGGTGTGGTCTGGCATTGGCCTGACTTTTTAAAAGGTTTTTCTGTTTTCTTCCCCACCCTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGAAGGATGTGAGAATCCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837568
dbEST ID: 79655270
Trimmed Sequence: CCGCTGCTTTAGCAAAGCTTTGTACATGGCAAAACCTAGAACGGCAAAGATGGTTGCACCAAAGCTTGCCCGCAGCCAAAAGGTTGAATTTTTCAATTCCGCCTGCGACATGTGCGGATACATGGCCATTGTGGTCATTTTGATGAAGATCTCCCTGCTGGGGCTCTCTGCCGTGTTGCAGGTAAAGGCTTGGGGTGGAGGCATCTTGTGCTTTTTGCAGAATTCTGCTGGAGAAATGCTGCTCTCCTGTTTCACTTCATGAAGGTCAGATTTGGATCCTACAAGCAGACAGGGCGTCCGGCTGTCCATGAAGTGTTGCTTAAATATCCTGGCACAATAGTCAAATGATTTGGGATTAGTGACATCATAGACCAAACAGACTACATCACACACAGCATCAGTGGGAGACAAAGCTTCACACTCCATCACATGGTGCAGCAGCAAATACTTCTCCTGGCCATACACATATACCGGGTTAATTGCATAGAAGGACTTATGCTGCTCTCGGATTCTCGTCTGTCTCATCAGGTTCCTCCCTAAATGGGACTGGAGAATCCCACATTTGCCACTGCCTTGGGAACCAATCACATTGCACCTGAACACATTACGCTGTGTCTGCCGCTTATGCAGGTCAATCTTCTTATCTCTAGTCACTGTGACTGGCCATGGCCTGGGACTCCTGGTTCTGTTAATATGGGAATAACCCCAAAATACCCCAAAAAAATCCCAGCAACCTCGTCCCCATTCCCCGGGTATGGTT
Full Trace Sequence: GGGGAAAATGTCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCGCTGCTTTAGCAAAGCTTTGTACATGGCAAAACCTAGAACGGCAAAGATGGTTGCACCAAAGCTTGCCCGCAGCCAAAAGGTTGAATTTTTCAATTCCGCCTGCGACATGTGCGGATACATGGCCATTGTGGTCATTTTGATGAAGATCTCCCTGCTGGGGCTCTCTGCCGTGTTGCAGGTAAAGGCTTGGGGTGGAGGCATCTTGTGCTTTTTGCAGAATTCTGCTGGAGAAATGCTGCTCTCCTGTTTCACTTCATGAAGGTCAGATTTGGATCCTACAAGCAGACAGGGCGTCCGGCTGTCCATGAAGTGTTGCTTAAATATCCTGGCACAATAGTCAAATGATTTGGGATTAGTGACATCATAGACCAAACAGACTACATCACACACAGCATCAGTGGGAGACAAAGCTTCACACTCCATCACATGGTGCAGCAGCAAATACTTCTCCTGGCCATACACATATACCGGGTTAATTGCATAGAAGGACTTATGCTGCTCTCGGATTCTCGTCTGTCTCATCAGGTTCCTCCCTAAATGGGACTGGAGAATCCCACATTTGCCACTGCCTTGGGAACCAATCACATTGCACCTGAACACATTACGCTGTGTCTGCCGCTTATGCAGGTCAATCTTCTTATCTCTAGTCACTGTGACTGGCCATGGCCTGGGACTCCTGGTTCTGTTAATATGGGAATAACCCCAAAATACCCCAAAAAAATCCCAGCAACCTCGTCCCCATTCCCCGGGTATGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCGCTGCTTTAGCAAAGCTTTGT