ORFeome > rilp ORF1 – XORFeome v1.0

rilp ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rilp
Gene ID: 5828946
Gene Page ID: 5828911
ORF Xenbase ID: 17293479

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123226
Original XGC clone length: 1182

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ838231
dbEST ID: 79655933
Trimmed Sequence: ATGGAGTCGCTATGGGTGAAGGGCCCGGGGTCCCTGTCGGTGCAGGATGTGTACAACATGGCGGTGTGTCTGGGCTCAGAACTGCAAACGCTCACGGAGCAGTATGGGCCGGACGCGGTATCCGGTGTAGTGCCGCAAGTGGTCCGTGTCCTGGAGTTGCTGGAAAGCTACGCGGGGGGTTCCGGGAGGGAGAGGAGCTGCACTGAGGAAGAATTGCTCATCAGAGCCGAGCACAGGTTGCAGTTCAGCAGCAGAGAGGAGCCGGCTCCGGCGGAGCAGCTGCTTGAAGCCCAGAAGAAGGAGCATGTTCTGCAGAATCAGCTGTCCCAGCTCACAGAAGAGAATCAGAAACTTCTTGGGCAGTTGGCTGAGCGCAAGTCAAAAGAAGACTGTGCTGTGAGAGAGGAGCGGGACCTGATGCTTCAGTTGAAGAAGGTAGTGGACATGCAGCGGGACCAGATTCGTGCCCTGACTCATGAAACCACACAGAAAAACAAGGACACAGAAGCGTTGCAGGAACAATTGGACAGGTTTATGAAAATGAATGAAGACTTGCGCCATAAAATGTCTGTGCTCCAAGCCCAGCTGAAAAGCTCTTTGCAGAGAAAAACTGAACTGGAAACCTTGCTACAAGGAAGGCAGATAGAAAATGATACTGTGTCTAAAAACAGCGTTGTACCGCCTGGTATCACAGACCGTAATATGGACACAAAATTTAAGTGCCACTCCACCCGCTTCCAAAGAAGAATCGGGTATCTGGCCCGCCATGTTTTCCGGAAAGGAAGGAGGTAAAACCAAAAAATTAAGGGAAACCCCATGG
Full Trace Sequence: GGGGCCCAAATAATAGATTTTATTTATGACTGATAGTGACCTGNTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTCGCTATGGGTGAAGGGCCCGGGGTCCCTGTCGGTGCAGGATGTGTACAACATGGCGGTGTGTCTGGGCTCAGAACTGCAAACGCTCACGGAGCAGTATGGGCCGGACGCGGTATCCGGTGTAGTGCCGCAAGTGGTCCGTGTCCTGGAGTTGCTGGAAAGCTACGCGGGGGGTTCCGGGAGGGAGAGGAGCTGCACTGAGGAAGAATTGCTCATCAGAGCCGAGCACAGGTTGCAGTTCAGCAGCAGAGAGGAGCCGGCTCCGGCGGAGCAGCTGCTTGAAGCCCAGAAGAAGGAGCATGTTCTGCAGAATCAGCTGTCCCAGCTCACAGAAGAGAATCAGAAACTTCTTGGGCAGTTGGCTGAGCGCAAGTCAAAAGAAGACTGTGCTGTGAGAGAGGAGCGGGACCTGATGCTTCAGTTGAAGAAGGTAGTGGACATGCAGCGGGACCAGATTCGTGCCCTGACTCATGAAACCACACAGAAAAACAAGGACACAGAAGCGTTGCAGGAACAATTGGACAGGTTTATGAAAATGAATGAAGACTTGCGCCATAAAATGTCTGTGCTCCAAGCCCAGCTGAAAAGCTCTTTGCAGAGAAAAACTGAACTGGAAACCTTGCTACAAGGAAGGCAGATAGAAAATGATACTGTGTCTAAAAACAGCGTTGTACCGCCTGGTATCACAGACCGTAATATGGACACAAAATTTAAGTGCCACTCCACCCGCTTCCAAAGAAGAATCGGGTATCTGGCCCGCCATGTTTTCCGGAAAGGAAGGAGGTAAAACCAAAAAATTAAGGGAAACCCCATGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTCGCTATGGGTGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838230
dbEST ID: 79655932
Trimmed Sequence: GTCATTTTCATTAGATGTTTCCCCCTTTTGTTCCTGGTTGATTTCCTTTGGACTAATAATCTCCCACGGTGCTGTATCATCTGTCTGCTTGCTGTACCACGTGCCAAACAAACTCTTGATTTTGGAATCTGGAGGCTTAGAATCCACACAGTCTGTGCCAGCTGTCTGCATCCAAGTGTTATCCTCGTCATCACTGCTGGTTGCAGACTCTGTGATTCCCAACATTTTGACCTTGATCTTTTTCCGTTGCTTTCTTATGGCAGATTTAATTCCACGCAACAAGAGACTTGGCATCCTCTCATCATTCAGCAACTCCCTCTGAAAATACTGCAATTCCTCATTCACAAGGAACAGGTTTGTTTTCAATTCATTGCGTTCCTGTAATATCTGCTTTACCTCCTCCTTCGTGAAACATGGCTGGCTAGATACAGAATCCTCTTTTGATGCAGGTAGAGTGGCACATAATGTTGTGTTCATATTACTGTCTGTGATACCAGGCGCTACAACGCTGCTTTTAGACACAGTATCATTTTCTTTCTGCCTTTCCTGTAGCAAGGTTTCCAGTTCAGTTTTTCTCTGCAGAGAGCTTTTCAGCTGGGCTTGGAGCACAGACATTTTATGGCGCAAGTCTTTCTTCATTTTCATAAACCTGTCCCATTGTTTCCGCAACGCTCCTGTGTCCCTGTTTTTCTGTTTTGGTTTCATGAAGTCAGGGCACCAATCTGTGGTCCCGCTGCCAGGTTCACTTACCTTCTTTTCACTGAAAGCATTTAGGGTCCCGGCCTCT
Full Trace Sequence: ACAAGTGGGTAATACGACTCACTATNAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCATTTTCATTAGATGTTTCCCCCTTTTGTTCCTGGTTGATTTCCTTTGGACTAATAATCTCCCACGGTGCTGTATCATCTGTCTGCTTGCTGTACCACGTGCCAAACAAACTCTTGATTTTGGAATCTGGAGGCTTAGAATCCACACAGTCTGTGCCAGCTGTCTGCATCCAAGTGTTATCCTCGTCATCACTGCTGGTTGCAGACTCTGTGATTCCCAACATTTTGACCTTGATCTTTTTCCGTTGCTTTCTTATGGCAGATTTAATTCCACGCAACAAGAGACTTGGCATCCTCTCATCATTCAGCAACTCCCTCTGAAAATACTGCAATTCCTCATTCACAAGGAACAGGTTTGTTTTCAATTCATTGCGTTCCTGTAATATCTGCTTTACCTCCTCCTTCGTGAAACATGGCTGGCTAGATACAGAATCCTCTTTTGATGCAGGTAGAGTGGCACATAATGTTGTGTTCATATTACTGTCTGTGATACCAGGCGCTACAACGCTGCTTTTAGACACAGTATCATTTTCTTTCTGCCTTTCCTGTAGCAAGGTTTCCAGTTCAGTTTTTCTCTGCAGAGAGCTTTTCAGCTGGGCTTGGAGCACAGACATTTTATGGCGCAAGTCTTTCTTCATTTTCATAAACCTGTCCCATTGTTTCCGCAACGCTCCTGTGTCCCTGTTTTTCTGTTTTGGTTTCATGAAGTCAGGGCACCAATCTGTGGTCCCGCTGCCAGGTTCACTTACCTTCTTTTCACTGAAAGCATTTAGGGTCCCGGCCTCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCATTTTCATTAGATGTTTCCCC