ORFeome > rilpl1 ORF1 – XORFeome v1.0

rilpl1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rilpl1
Gene ID: 952716
Gene Page ID: 952709
ORF Xenbase ID: 17293485

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123187
Original XGC clone length: 1185

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ838333
dbEST ID: 79656035
Trimmed Sequence: ATGGAGGGGATCTCAGCCCTGGAAAAGAATGTGGCCGAGCTGACAGTTATGGATGTCTATGACATCGCCTCTGCAGTGGGACAGGAGTTCGAGAGGGTCATTGACCAATATGGCTGCGAAGTTATCGGCAGACTCATGCCTAAAGTGGTCCGGGTGCTGGAAATTCTGGAGGTTCTGGTCAGTAGGAACCACATCAACCCAGAGATGGAAGAGCTGAGACTGGAACTGGACAGACTGAGGCTGGAACGAATGGACAGGATAGAAAAGGAAAAGAAGCACCTGAAGGAGCTTGAGCTGGTGGAAGATGTGTGGAGAGGGGAAGCACAGGATCTCCTGAATCATATATCTCAGCTTCAGGAAGAAAACAAGCAGCTTTTAACTAACCTGTCCCACAAGGATGTCAATCTCACCGAGGAGGAGTTTCAGAAACATGAAGGAATGTCTGACAGGGAAAGACAAGTTATGAAGAAGTTAAAGGAGGTGGTGGACAACCAAAGGGATGAATTAAGGGCTAGAGACCGTGAACTAGTGCTTAAGGGTGAAGGTGTAGAAACCTTACGGCAGCAGCAAAGCCGCCTAATAGAAATTATTCATGATTTTCCGGCCATCGGGTCCCTGTTGGTAAAGCTGAGGGGTAAGGGTGCGTAGGGAACAAAATGTTAAAATTGAAAGGGTGTTTTGCAAGGCAGAGGAACAGAAAGCCCCCCGCCCACGAAAAAAAAAAAATTTATTGAAGCTTGGGGGGGGAAAAATTGAAGAGGAAAAAGCCTGTGGAGCGGGTGGCAGCACAGAAAGAAGGAGAGAAAGAAAGAAACTTAGAAA
Full Trace Sequence: TCGGGGCCCATATAATGGATTTTATTNTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGGGATCTCAGCCCTGGAAAAGAATGTGGCCGAGCTGACAGTTATGGATGTCTATGACATCGCCTCTGCAGTGGGACAGGAGTTCGAGAGGGTCATTGACCAATATGGCTGCGAAGTTATCGGCAGACTCATGCCTAAAGTGGTCCGGGTGCTGGAAATTCTGGAGGTTCTGGTCAGTAGGAACCACATCAACCCAGAGATGGAAGAGCTGAGACTGGAACTGGACAGACTGAGGCTGGAACGAATGGACAGGATAGAAAAGGAAAAGAAGCACCTGAAGGAGCTTGAGCTGGTGGAAGATGTGTGGAGAGGGGAAGCACAGGATCTCCTGAATCATATATCTCAGCTTCAGGAAGAAAACAAGCAGCTTTTAACTAACCTGTCCCACAAGGATGTCAATCTCACCGAGGAGGAGTTTCAGAAACATGAAGGAATGTCTGACAGGGAAAGACAAGTTATGAAGAAGTTAAAGGAGGTGGTGGACAACCAAAGGGATGAATTAAGGGCTAGAGACCGTGAACTAGTGCTTAAGGGTGAAGGTGTAGAAACCTTACGGCAGCAGCAAAGCCGCCTAATAGAAATTATTCATGATTTTCCGGCCATCGGGTCCCTGTTGGTAAAGCTGAGGGGTAAGGGTGCGTAGGGAACAAAATGTTAAAATTGAAAGGGTGTTTTGCAAGGCAGAGGAACAGAAAGCCCCCCGCCCACGAAAAAAAAAAAATTTATTGAAGCTTGGGGGGGGAAAAATTGAAGAGGAAAAAGCCTGTGGAGCGGGTGGCAGCACAGAAAGAAGGAGAGAAAGAAAGAAACTTAGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGGGATCTCAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ838332
dbEST ID: 79656034
Trimmed Sequence: CATGTGCTGTAATGCTTCTTGTCCTTGTTCTGTATAAACGTCATCCCTGTTATAATTTGTCCATTCTCCAAAGGATTCCTGGAAGTGGACATTCTTCTGCATCATCGGCATGCGCTTTTTATCTCTTGAGAAAAAACTAAACAGTCGTTTGATGCCAGACTCCTGAGGGATGGGTGCTTTAGAATTAATCACAGGCAAAGATTGTGGCAGTTTGTTTTCTTCCTCTGCTTCTTCGCTTTTATAATAAGCAAGTTCTTCTTGCAGCATAAAGACTTTGGCTTTAAGCTCATTTCTCTCATGTAAGACATCTCTCAGCTCTTGTAAGGTAAATCTGGGCCGGTTGGAATCTTTAAGATCCAGAGAAAATTTTTCTGTTTCAAAGATACACTCTTCATTTAGAGTTTCTGTCTTTATCTCCTCTCCATTTGTATGATGCTCTCCTTTCAGTTTGTCCCTCAGTTTACCAATCTCTATTCTCATGCTGGCTGCTTCCTGTTCCTTTGTTTGCAAATACGCTTCCAGTTCCACCTTTTGTTCAATCAAAGCCTTACCCTGAGCTTCTACCACAGTGACACGATGCCGCAAATCATGAATAATTTTTATTAGGGCGCTTTGCTGCTGCTGTAAAGGTTCTAACTCCCTCATTTTTAAGCACTAATTTAAGGGTCTCTTGCCCCTTAATTTATCCCCTTTTGCTTGTCTACCACCCTCCTTTTAACTTTCTTCAAAAACTTTGTCCCTTTCCCTTCTTAAGAAAATTTCTCCTTC
Full Trace Sequence: GGGAAAATGTCTATGACCATGTAATACGACTCACTATANGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGTGCTGTAATGCTTCTTGTCCTTGTTCTGTATAAACGTCATCCCTGTTATAATTTGTCCATTCTCCAAAGGATTCCTGGAAGTGGACATTCTTCTGCATCATCGGCATGCGCTTTTTATCTCTTGAGAAAAAACTAAACAGTCGTTTGATGCCAGACTCCTGAGGGATGGGTGCTTTAGAATTAATCACAGGCAAAGATTGTGGCAGTTTGTTTTCTTCCTCTGCTTCTTCGCTTTTATAATAAGCAAGTTCTTCTTGCAGCATAAAGACTTTGGCTTTAAGCTCATTTCTCTCATGTAAGACATCTCTCAGCTCTTGTAAGGTAAATCTGGGCCGGTTGGAATCTTTAAGATCCAGAGAAAATTTTTCTGTTTCAAAGATACACTCTTCATTTAGAGTTTCTGTCTTTATCTCCTCTCCATTTGTATGATGCTCTCCTTTCAGTTTGTCCCTCAGTTTACCAATCTCTATTCTCATGCTGGCTGCTTCCTGTTCCTTTGTTTGCAAATACGCTTCCAGTTCCACCTTTTGTTCAATCAAAGCCTTACCCTGAGCTTCTACCACAGTGACACGATGCCGCAAATCATGAATAATTTTTATTAGGGCGCTTTGCTGCTGCTGTAAAGGTTCTAACTCCCTCATTTTTAAGCACTAATTTAAGGGTCTCTTGCCCCTTAATTTATCCCCTTTTGCTTGTCTACCACCCTCCTTTTAACTTTCTTCAAAAACTTTGTCCCTTTCCCTTCTTAAGAAAATTTCTCCTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGTGCTGTAATGCTTCTTGT