ORFeome > ripk1 ORF1 – XORFeome v1.0

ripk1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ripk1
Gene ID: 1012370
Gene Page ID: 1012364
ORF Xenbase ID: 17293527

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129546
Original XGC clone length: 2004

Human orthology & disease relationships

NCBI Entrez ID: 8737
Ensembl gene IDs: ENSG00000137275
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 142680,180849,209950,300291,300301,300584,308300,601859,606843,607271

Library Location

Plate ID: GDExl11086
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ837874
dbEST ID: 79655576
Trimmed Sequence: ATGGCAGAAGGCATATCTCTGGATGATATTGTTATGAAGTCCGAAGACTTAATAACCCACCAGAAACTTGATTCTGGAGGATATGGACTGGTGTCTTTATGCCATCATCGGTTTCATGGACTGGTTGTATTGAAAACAGTATACACTGGACATATGCATTCTCAGTACAATGAAAAACTTCTTGAAGAGGGTAAAATTATGCATATGTTAAAGAATGACCGAGTGGTAAAGCTTCTTGGCCTCATATTAGAAAATGGGAACTATTCGCTGGTGATGGAGTGTATTAATAATGGAAATTTATTGACTGTTTTAGAAAAGATTGAACTTTCTCTCTCATTTAAAACCTGTTTTATTCTATAAATTATTGAAAAATTGCATTTCGTTCCAAATAACAAATTTTTATATATCGATTTAAAACCATCTTTCAGGTTACTACTTAGAACCTTTCCCTTGCGATATTGCTAACGTTTTGCTTCAATGCCCTTTAAAAATCTGAACAAAAAATCTAAATAAAACAAGTGTTGCAAGCAAAAAATATACATAGCCACAAAAACAAAAATGAGAAAAAATGGATATGTTAGTTTGATTGCTTGGAGAAAAAGACACAGAATGNGGGNGGATGGGAGAAAGGGTGAAAGAGAGANTAGGAGGCGAAGAGAAGNGCGATGGAGAATAAGACCACGAACGTGGCTAAGACGAGGGACGANAGGTATAAAAAAAAATAAAATGGAAGATGATNGCGTAATGNCTATTATGAGAATNCGTATTANGGNNACAGTGATGAGANCGAGAACANTNCGACGAGCACAAAAAAACAAAAGGAGAAGGTAGAGAGATAAGAAAGGAGTAAAGAAATAGGTNGGN
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAGGCATATCTCTGGATGATATTGTTATGAAGTCCGAAGACTTAATAACCCACCAGAAACTTGATTCTGGAGGATATGGACTGGTGTCTTTATGCCATCATCGGTTTCATGGACTGGTTGTATTGAAAACAGTATACACTGGACATATGCATTCTCAGTACAATGAAAAACTTCTTGAAGAGGGTAAAATTATGCATATGTTAAAGAATGACCGAGTGGTAAAGCTTCTTGGCCTCATATTAGAAAATGGGAACTATTCGCTGGTGATGGAGTGTATTAATAATGGAAATTTATTGACTGTTTTAGAAAAGATTGAACTTTCTCTCTCATTTAAAACCTGTTTTATTCTATAAATTATTGAAAAATTGCATTTCGTTCCAAATAACAAATTTTTATATATCGATTTAAAACCATCTTTCAGGTTACTACTTAGAACCTTTCCCTTGCGATATTGCTAACGTTTTGCTTCAATGCCCTTTAAAAATCTGAACAAAAAATCTAAATAAAACAAGTGTTGCAAGCAAAAAATATACATAGCCACAAAAACAAAAATGAGAAAAAATGGATATGTTAGTTTGATTGCTTGGAGAAAAAGACACAGAATGNGGGNGGATGGGAGAAAGGGTGAAAGAGAGANTAGGAGGCGAAGAGAAGNGCGATGGAGAATAAGACCACGAACGTGGCTAAGACGAGGGACGANAGGTATAAAAAAAAATAAAATGGAAGATGATNGCGTAATGNCTATTATGAGAATNCGTATTANGGNNACAGTGATGAGANCGAGAACANTNCGACGAGCACAAAAAAACAAAAGGAGAAGGTAGAGAGATAAGAAAGGAGTAAAGAAATAGGTNGGN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAGGCATATCTC

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGGCAGGGAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGATGCCTCCACGTTCATTAAGGCATGCATAAGCTCACTTTCCCCCACCACATAGACTGCTTTGACCACCTTTCCTCCAATATCATTTTTGGAGCCCTCTTTCATTATCCATTTATCCACTGATTGGTGCACTTATTCCTGCAAGACGTCTCTCTCATAATCGTGGATCGATTTCATCCATCGCTTACTGACTTAAACACAAACAGCCAATAAAGAATATCATTTTTTAAAAACACCATTCCCTATCCACCCGAATCAAATTTTTTTTTGGTTATTAAATCTTCTAACTTCATCACAATATCCTCCAGAGTAATTCCTTCTGCCATCCTGTCCGCTTTTTTGTACCAATTTGACATTATAAAAAAACACTGCTCGTCAATTTATTGCAACGAACAATTCACTATCAGTCAAACTATAATCATTATTTGCGGCCCGATCCTTATACTGGACGTCAAAATAAAAGTCTTAACATGGCGAGATACGACTTCTTGAGTAAAAAGATGAAAAAGAGACAAAAGAGAAGGAAGAAAGGAAGAGAGAAGCNGAGATTTAGTAAGAAAGAAGGCAAAGTTTGGGACGCAGGGGGGGNCAGAACGAGAAAGAGAAGAACGAGAGGGCAGGGCGGGGAATAGATAAAAAAGAGGGGAGAGAGNGAAGAGAAGGACGATGAAGGGGAAAAAAAAAGAAAGAAAGGGGTAGGAGAGGAGAGAAGAGTGGATCGGNGGCGAGGGAAGAGAAGAGGAGGAGAGAGAGGAGGGCGGAGAGGGGGGAGGAGAGGANGGGGAAGAGAAGAGGAAGAAGGAGGGAAAGGGGGGGAGTAGAAAAAGAGGGGAAGAAAAGAAGAAGGGAGGAGAAGGAGAAGGAGGGGGGGGAGAAAAAAAAAGANCGNAGGATAAGGANATGGGNAAGAGAGAGAGGGGGCNGGGGGGAGGAAACAGGCGANAAGAGGNAGAGANNGGNGGGGTGNGAGGGAGAGAGNAATNGGNNAGGAANGTGGAANNCNAGANNTAGGGGGGGGCGGGTTATGCGGGAAGGGANAGGAGNNTGNCGGGGNGAANNGNATGAGANAGGNGGAGAGGNGGANGGGAGGAANANGNGGGGGCNNCANGGGGGAATGGGNAAGGAGCCGGGCGGAGGAGCTNCGNNNNCGNGGGGNGAGGTGCNGGGTAGGNGGGGCGGGAACGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGATGCCTCCACGTTCATT