ORFeome > rlbp1 ORF1 – XORFeome v1.0

rlbp1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rlbp1
Gene ID: 976309
Gene Page ID: 976302
ORF Xenbase ID: 17293551

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054209
Original XGC clone length: 954

Human orthology & disease relationships

NCBI Entrez ID: 6017
Ensembl gene IDs: ENSG00000140522
Directly associated (OMIM) disease MIM numbers: 136880,607475,607476
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ839327
dbEST ID: 79657029
Trimmed Sequence: ATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATACGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTCTTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCCTCCCAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGAATTTAAAGCTGGTCACTTTTATCATCAACCCCTGGTACTTCCCTACCCACATACCAATGGTTGTTGAAACCGTTTCCTGGAAAAACAAACCTTACTGGGAAAAAG
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATACGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTCTTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCCTCCCAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGAATTTAAAGCTGGTCACTTTTATCATCAACCCCTGGTACTTCCCTACCCACATACCAATGGTTGTTGAAACCGTTTCCTGGAAAAACAAACCTTACTGGGAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGAGATAACTGGAACCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839326
dbEST ID: 79657028
Trimmed Sequence: AAGAGCAGTGTCTTCTGATTCGTTTCTTGGCCCAAAAAGTTTCTCAGCGATAATTTTCCCGTCATATTTTGGCAGATTCCCCCCAAAGTCAGCTGGCAGGATGTCAGCATCTATTTCCTTGAAGAAGCCTTCCAGGCCGTCTCCATGTACAAACACCCTCTCCAGTAGCTTGCTCTTCAGGAACGGTTTCACAACATTGTATGTGGTAGTGAAGTACCAGGGCTGATGAATAAAGTGTACAGCCTTAAATCTGGCTGGGAACGAGTCCTGTAGCATGTCCACCATTTTCTTCAGCTCGGATGGCTTTATGCCTGAAGCTTGCTGCATGGTGAATCCTTTGAAATTCTCAATAATGCAGAAGCCATTAATCTGAGTCTCCTCGTTTTCCAGCAAGTTCTCCAGTATAATGCAGTAAGCTCGGAGGATCTCATCAAAGGTGATCTCCTCGTAGTCCCAATTTTCAATGTTAAAAAGGAGGATAACTCTGCCGTTCTTATCTCTGCTGGTCAAGATTCCTGGATATCCGGCTTCAATAGTGCTCCGCACCGCCTCCGGGTGTCAGGTCCTCAAAGAGTTCTGGGTACTGCCTGGCGGAATTTTACATATCCTTTCAGGAGTTCATAGGCTCGGCTCAAATTCAAATTTCCGGGCCCGTAGGACCCTCAGGGAGGAAATTATTTTCCCTTTGTCCTTTGACTTTTCCCGGCCCACTGCCTTTTGCAAAACCTAACCCCCCTGCCCTTTGCCCCTTCTCCCTGAACCCAAGGTGGCCGA
Full Trace Sequence: CGGGGAACAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGAGCAGTGTCTTCTGATTCGTTTCTTGGCCCAAAAAGTTTCTCAGCGATAATTTTCCCGTCATATTTTGGCAGATTCCCCCCAAAGTCAGCTGGCAGGATGTCAGCATCTATTTCCTTGAAGAAGCCTTCCAGGCCGTCTCCATGTACAAACACCCTCTCCAGTAGCTTGCTCTTCAGGAACGGTTTCACAACATTGTATGTGGTAGTGAAGTACCAGGGCTGATGAATAAAGTGTACAGCCTTAAATCTGGCTGGGAACGAGTCCTGTAGCATGTCCACCATTTTCTTCAGCTCGGATGGCTTTATGCCTGAAGCTTGCTGCATGGTGAATCCTTTGAAATTCTCAATAATGCAGAAGCCATTAATCTGAGTCTCCTCGTTTTCCAGCAAGTTCTCCAGTATAATGCAGTAAGCTCGGAGGATCTCATCAAAGGTGATCTCCTCGTAGTCCCAATTTTCAATGTTAAAAAGGAGGATAACTCTGCCGTTCTTATCTCTGCTGGTCAAGATTCCTGGATATCCGGCTTCAATAGTGCTCCGCACCGCCTCCGGGTGTCAGGTCCTCAAAGAGTTCTGGGTACTGCCTGGCGGAATTTTACATATCCTTTCAGGAGTTCATAGGCTCGGCTCAAATTCAAATTTCCGGGCCCGTAGGACCCTCAGGGAGGAAATTATTTTCCCTTTGTCCTTTGACTTTTCCCGGCCCACTGCCTTTTGCAAAACCTAACCCCCCTGCCCTTTGCCCCTTCTCCCTGAACCCAAGGTGGCCGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGAGCAGTGTCTTCTGATTCGT