ORFeome > rmdn1 ORF1 – XORFeome v1.0

rmdn1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rmdn1
Gene ID: 974339
Gene Page ID: 974331
ORF Xenbase ID: 17293563

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054253
Original XGC clone length: 927

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ839439
dbEST ID: 79657141
Trimmed Sequence: ATGTTCGCTCGCCGGGTTCAGGAAATGCTTCGTTGCCCCCTCTTTCGGCTGGGGACCAGAAGCAGCCCCCGAACTTCGGGCAGGATTGTCCCTGTTGGCTCCTCTGCTACTGCTGGTGGGAAGATCGCTTTGCTGGAGAGAGGCATTATCCTTTCATCAGTTGCCTACTTAGCATTTGAAACCTACAAATGGAAAAGAGGCCAAACAGTTGTACACGCCAGCATTAAAGTTGAAGATATCGTAGAGCAAGCGGATTACTTATATGGCAGCGGAGAGACCATAAAGTTATATGAACTTCTTAGCCAGTACAAAGACAGAAATGACGCTGAGCTTCTGTGGAGACTCGCCCGGGCAGCGCGAGACATGACACTCCTTTCCACAACCCCTCGAGATGAGAAGAAGAGACTGGTTTATGAGTCCTTCGACTGTGCTAAGAAAGCTCTAGAAGTTGATGAGCTGTGCTGGGCAGCACACAAGTGGTACAGCATATGCCTGAGCAACGTCGGTGATTACGAAGGAATCAAAACGAAAATTGGGAACGCCTATATTGTAAAAGAGCACCTTGAGAGAGCCAAAGAGCTAAATCCAAAGGACGCCACCACTATTCATATCATTGGGGGTGTGGTGTTACATGTTTGCAGACCTTCCCTGGTACCAAGTTAAATAGCCTCAGCTTTATTTGGAACCCACCCTCTGCTACATTCGAAGAAGGCCTCACATACTTCCTGCAAGGCGAAGGAAGTCGATCCACACTTTTATAGTTACAATCTTCTGTTTTTGGGGGAAAACTTAATTGAAATTTAAAAAAACAAGTCCCCTGGCC
Full Trace Sequence: TCGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCGCTCGCCGGGTTCAGGAAATGCTTCGTTGCCCCCTCTTTCGGCTGGGGACCAGAAGCAGCCCCCGAACTTCGGGCAGGATTGTCCCTGTTGGCTCCTCTGCTACTGCTGGTGGGAAGATCGCTTTGCTGGAGAGAGGCATTATCCTTTCATCAGTTGCCTACTTAGCATTTGAAACCTACAAATGGAAAAGAGGCCAAACAGTTGTACACGCCAGCATTAAAGTTGAAGATATCGTAGAGCAAGCGGATTACTTATATGGCAGCGGAGAGACCATAAAGTTATATGAACTTCTTAGCCAGTACAAAGACAGAAATGACGCTGAGCTTCTGTGGAGACTCGCCCGGGCAGCGCGAGACATGACACTCCTTTCCACAACCCCTCGAGATGAGAAGAAGAGACTGGTTTATGAGTCCTTCGACTGTGCTAAGAAAGCTCTAGAAGTTGATGAGCTGTGCTGGGCAGCACACAAGTGGTACAGCATATGCCTGAGCAACGTCGGTGATTACGAAGGAATCAAAACGAAAATTGGGAACGCCTATATTGTAAAAGAGCACCTTGAGAGAGCCAAAGAGCTAAATCCAAAGGACGCCACCACTATTCATATCATTGGGGGTGTGGTGTTACATGTTTGCAGACCTTCCCTGGTACCAAGTTAAATAGCCTCAGCTTTATTTGGAACCCACCCTCTGCTACATTCGAAGAAGGCCTCACATACTTCCTGCAAGGCGAAGGAAGTCGATCCACACTTTTATAGTTACAATCTTCTGTTTTTGGGGGAAAACTTAATTGAAATTTAAAAAAACAAGTCCCCTGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCGCTCGCCGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839438
dbEST ID: 79657140
Trimmed Sequence: GATTTTTTCACCCAAGCTCTTTAGTAGGTCAGTAGCTTCTTTTTGAACCTCAATGTCCTCATCGGAGCGTGCAGGGAAATCCTTGGCCTTAGTTAGCCAGTCTAGTGCCAGCGACTTGTTCTTTAACTTCAAATACGTTTTCCCCAAAAACAGAAGATTTGTACTATAAAAGTGTGGATCGACTTCCTCTGCCTGCAGAAAGTATGTGAGGGCCTCTTCGAATGTAGCAGAGGGTGGGGTTCCAAATAAAGCTGAGGCTATTTTAACTTGGTACCAGGGAAGGTCTGCAAACATGTAACACCACACCCCAATGATATGAATAGTGGTGGCGTCCTTTGGATTTAGCTCTTTGGCTCTCTCAAGGTGCTCTTTTACAATATAGGCGTTCCCAATTTTCGTTTTGATTCCTTCGTAATCACCGACGTTGCTCAGGCATATGCTGTACCACTTGTGTGCTGCCCAGCACAGCTCATCAACTTCTAGAGCTTTCTTAGCACAGTCGAAGGACTCATAAACCAGTCTCTTCTTCTCATCTCGAGGGGTTGTGGGAAGGAGTGTCATGTCTCGCGCTGCCCGGGCGAGTCTCCACAGAAGCTCAGCGTCATTTCTGTCTTTGTACTGGCTAAGAAGTCCAAATAACTTTATGGTCTCTCCGCTGCCCTATAAGTAATCCGCTTGCTCTAACATATCTTCCACTTTAAATGCCTGGCGGGGAACAACCGGTTTGGGCCTCCTTTTTTCAATTGGTTAGG
Full Trace Sequence: AAAATGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATTTTTTCACCCAAGCTCTTTAGTAGGTCAGTAGCTTCTTTTTGAACCTCAATGTCCTCATCGGAGCGTGCAGGGAAATCCTTGGCCTTAGTTAGCCAGTCTAGTGCCAGCGACTTGTTCTTTAACTTCAAATACGTTTTCCCCAAAAACAGAAGATTTGTACTATAAAAGTGTGGATCGACTTCCTCTGCCTGCAGAAAGTATGTGAGGGCCTCTTCGAATGTAGCAGAGGGTGGGGTTCCAAATAAAGCTGAGGCTATTTTAACTTGGTACCAGGGAAGGTCTGCAAACATGTAACACCACACCCCAATGATATGAATAGTGGTGGCGTCCTTTGGATTTAGCTCTTTGGCTCTCTCAAGGTGCTCTTTTACAATATAGGCGTTCCCAATTTTCGTTTTGATTCCTTCGTAATCACCGACGTTGCTCAGGCATATGCTGTACCACTTGTGTGCTGCCCAGCACAGCTCATCAACTTCTAGAGCTTTCTTAGCACAGTCGAAGGACTCATAAACCAGTCTCTTCTTCTCATCTCGAGGGGTTGTGGGAAGGAGTGTCATGTCTCGCGCTGCCCGGGCGAGTCTCCACAGAAGCTCAGCGTCATTTCTGTCTTTGTACTGGCTAAGAAGTCCAAATAACTTTATGGTCTCTCCGCTGCCCTATAAGTAATCCGCTTGCTCTAACATATCTTCCACTTTAAATGCCTGGCGGGGAACAACCGGTTTGGGCCTCCTTTTTTCAATTGGTTAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATTTTTTCACCCAAGCTCTTTAG