ORFeome > rnasek ORF2 – XORFeome v1.0

rnasek ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rnasek
Gene ID: 6254981
Gene Page ID: 6046201
ORF Xenbase ID: 17293617

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129756
Original XGC clone length: 306

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ838733
dbEST ID: 79656435
Trimmed Sequence: ATGGTGTCGCTGCTGTGCTGTGGGCCCAAGCTGGCCGCCTGTGGGATCGTCATCAGCGTGTGGGGAGTCATCATGCTGATTCTGCTGGGGGTGTTCTTTAACGTCCATTCGGCGGTTCTGATTGAGGACGTGCCCTTCACTGAAGAGGATATATTTGAGGACCCCAATCCTCCGGCCAAGATGTACCGCCTGTACGAGCAGGTCTCCTATAACTGCTTCATCGCCGCCGCCATCTACATTGTCCTGGGGGGCTTCTCCTTCTGTCAAGTGCGACTCAATAATAGGAAAGAATACATGGTCCGCTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGTCGCTGCTGTGCTGTGGGCCCAAGCTGGCCGCCTGTGGGATCGTCATCAGCGTGTGGGGAGTCATCATGCTGATTCTGCTGGGGGTGTTCTTTAACGTCCATTCGGCGGTTCTGATTGAGGACGTGCCCTTCACTGAAGAGGATATATTTGAGGACCCCAATCCTCCGGCCAAGATGTACCGCCTGTACGAGCAGGTCTCCTATAACTGCTTCATCGCCGCCGCCATCTACATTGTCCTGGGGGGCTTCTCCTTCTGTCAAGTGCGACTCAATAATAGGAAAGAATACATGGTCCGCTTGCCAACTTTCTTGTACAAATTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCACTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAATGAGGCGTATTACGGGGTCATAGATGTTTACTGGCAGCTCTTGGAAAAAAAAAAAAAAAAAAAAAAAAATAACAATTTTGTGATTCGGGGCTACAGAAAAAAAAAAAAAGAAAAAAAAAAAAAAACACTTGTTTTTTTGGTTTTTTTTTTTGTGAAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAGAAGAAGGGATTGTTGTTTGTGGTTTAAAAAAAATGTGAGGGAAAGCGACGAGAGAGCGCACAAAAACAACTAAAGAAAAAAAGGGGGGGGAAGGAGGGAAGGAATGGGGGGAGAAGGGGAGTATGTTATTTGTTTTTGTTTAAATAACACAGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGTCGCTGCTGTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838732
dbEST ID: 79656434
Trimmed Sequence: GCGGACCATGTATTCTTTCCTCTTATTGAGTCGCACTTGACAGAAGGAGAAGCCCCCCAGGACAATGTAGATGGCGGCGGCGATGAAGCAGTTATAGGAGACCTGCTCGTACAGGCGGTACATCTTGGCCGGAGGATTGGGGTCCTCAAATATATCCTCTTCAGTGAAGGGCACGTCCTCAATCAGAACCGCCGAATGGACGTTAAAGAACACCCCCCGCAGAATCAGCATGATGACTCCCCACACGCTGATGACGATCCCACAGGCGGCCAGCTTGGGCCCACAGCACAGCAGCGACACCATGG
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGGACCATGTATTCTTTCCTCTTATTGAGTCGCACTTGACAGAAGGAGAAGCCCCCCAGGACAATGTAGATGGCGGCGGCGATGAAGCAGTTATAGGAGACCTGCTCGTACAGGCGGTACATCTTGGCCGGAGGATTGGGGTCCTCAAATATATCCTCTTCAGTGAAGGGCACGTCCTCAATCAGAACCGCCGAATGGACGTTAAAGAACACCCCCCGCAGAATCAGCATGATGACTCCCCACACGCTGATGACGATCCCACAGGCGGCCAGCTTGGGCCCACAGCACAGCAGCGACACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGACTGGAAAAAAATAATAAACTCAAAAAACTAGAAAGCGCCCTGCCCCCGACCCAGAAAAAAAAAAAAAACATCGAACCAACCACAGGTGCGTGGGGGGGGTGCTCCGGGGAGAAAAGAAAAGAAAAAAACAAACAAAAAAGCAAGAATGTGGTTTTTTTTGTTTAAAGTGTGGTTGGGGCGCCCCGCCCCGGCTCAAAAACAATAAACAAACCACGGGGGGGGAGGGGGGGGTGGGGGTTTTGTGGGGGTGTTATTATTTGTTTTTTGTTGTGTTTGTTCCTTTCCCCCGGCCACCCCACCACCCCCGCGTCACCCCCCCCCGGGGGGGTCGTTTGTGACTGAGGTGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGGACCATGTATTCTTTCCT