ORFeome > rnf103 ORF2 – XORFeome v1.0

rnf103 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rnf103
Gene ID: 989827
Gene Page ID: 989823
ORF Xenbase ID: 17293647

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124968
Original XGC clone length: 2037

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ837328
dbEST ID: 79655030
Trimmed Sequence: ATGTGGCTGAAGCTGTTTTTCCTCCTGCTGTACTTCTCAATCCTGTTTGTCCTGGCGAGATTCTTTGAGACGATTGTGTGGTACGAAACGGGCATCTTTGCCAGCCAGCTGGTGGACCCTGTGACTCTGAGCTTTCACCAGCTGAAGACTATATTGGAATGCAGGGGTCTGGGATACTCGGGATTGCCGGAGAAGAAAGATGTCAGGGAGCTGGTGGAAAAATCAGGTGACCTGATGGAAGGGGAATTGTATTCTGCCATGAAGGAAGAAGAAGCCTCAGAGACTGTGTCCAGCACTAACTTCAGTGGGGAAATGCACTTTTATGAACTGGTGGAAGACACAAAAGATGGCATCTGGTTGGTGCAGGTAATTGCAAACGAACGAAGTCCCCTTGTAAGTAGAACCCACTGGGAAAAGATGGTCAAAAAAGTGACAAAATTCGGCATTCGCACCGGGACCTTTAACTGCTCCAGTGATCCCAGGTACTGCAGAAAGAGAGGGTGGATGAGATCAACGCTTATCATATCCGTGCCTCAGACCAGCACTTCTAAAGGCAAAGTGATGCTGAAGGAGTACAGTGGGCGCAAGATAGAAACCGAGCACATTTTCTAGTGGATAACCGCACACGCCTGCTCGCGGATTAAAACCATATAACATTCTGAACACCTGAAAAGACAAATGGAAAAAGAGCGACCAATACGGGGTCAAGCCTTTCCTTTTTCCCCAACCTCAATCAACCCTCCACCTTTTTTCTCTTCCCTTCTTCTTTTAATTTTACCAGGGAAAGGTCCAAATTTCCTAGTTTTGTAAAAAGTT
Full Trace Sequence: CGTGGGCCATATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGCTGAAGCTGTTTTTCCTCCTGCTGTACTTCTCAATCCTGTTTGTCCTGGCGAGATTCTTTGAGACGATTGTGTGGTACGAAACGGGCATCTTTGCCAGCCAGCTGGTGGACCCTGTGACTCTGAGCTTTCACCAGCTGAAGACTATATTGGAATGCAGGGGTCTGGGATACTCGGGATTGCCGGAGAAGAAAGATGTCAGGGAGCTGGTGGAAAAATCAGGTGACCTGATGGAAGGGGAATTGTATTCTGCCATGAAGGAAGAAGAAGCCTCAGAGACTGTGTCCAGCACTAACTTCAGTGGGGAAATGCACTTTTATGAACTGGTGGAAGACACAAAAGATGGCATCTGGTTGGTGCAGGTAATTGCAAACGAACGAAGTCCCCTTGTAAGTAGAACCCACTGGGAAAAGATGGTCAAAAAAGTGACAAAATTCGGCATTCGCACCGGGACCTTTAACTGCTCCAGTGATCCCAGGTACTGCAGAAAGAGAGGGTGGATGAGATCAACGCTTATCATATCCGTGCCTCAGACCAGCACTTCTAAAGGCAAAGTGATGCTGAAGGAGTACAGTGGGCGCAAGATAGAAACCGAGCACATTTTCTAGTGGATAACCGCACACGCCTGCTCGCGGATTAAAACCATATAACATTCTGAACACCTGAAAAGACAAATGGAAAAAGAGCGACCAATACGGGGTCAAGCCTTTCCTTTTTCCCCAACCTCAATCAACCCTCCACCTTTTTTCTCTTCCCTTCTTCTTTTAATTTTACCAGGGAAAGGTCCAAATTTCCTAGTTTTGTAAAAAGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGCTGAAGCTGTTTTTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837327
dbEST ID: 79655029
Trimmed Sequence: GGAAGGGGTTTCACTGGTAGAAGACTGAGGACGTGCAAAATGTTTCTTTTTATAGGATGCCCAGCGGCAAACTGGGCAGCAGTGTCTCCCTCCAGCCAGCCACATCACAATGCAATTTTGATGAAATACGTGACCGCAGGGCAAACCCATAAGCAAAGAGCGATTTTCAAAATTCTCTAAGCAAACAACACACTCTGTGCAATGCAACATGTTCCCAGGCCACGTGGCCCAGTTAGGCTCCATGTAGTTCTTAGTGCATCTGGATCCATAGGACAACCTGGTTTTGCTACCATTTGGGCTGGATTTTGGTGTGTTACAGGCACACGAGCAACTGTGATCGGCGCATTCTACTGCAGAATCTGCCTGGTGGAACGTGGCAGGAGCATCCTGTTCACATAAGTGTTTATCACCATTGTTTTCCAGTTCCGAGTCGCAGTCGCTCTCCTGGGATCCTTCTGAGGTTTCTTCATCTGAATGACATTGGAACTGCCATGTTGGTAGATTTTTTATGTAATCTGTTGGGATCAGAGGACGAAGCCATAAATCGGGAAACGCTAACCTCTCGAGAAACAGGTCTGGGTCTTCATCCCAATCGGAGTCCATGGGAAAATGGTTGATCAAACCAAATGGGGTGGAACAGGTAGCTTCTAACCCAGTCCCAAAGCTGGACAACCACTCCCAATTGTTGGCCTTTCCCTCTTTCTTCCTTTTCCTTTTACCTCCGCCCTTTTTCTTTCCTAAATTAATCCCAATGAA
Full Trace Sequence: GAGAAACCGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAAGGGGTTTCACTGGTAGAAGACTGAGGACGTGCAAAATGTTTCTTTTTATAGGATGCCCAGCGGCAAACTGGGCAGCAGTGTCTCCCTCCAGCCAGCCACATCACAATGCAATTTTGATGAAATACGTGACCGCAGGGCAAACCCATAAGCAAAGAGCGATTTTCAAAATTCTCTAAGCAAACAACACACTCTGTGCAATGCAACATGTTCCCAGGCCACGTGGCCCAGTTAGGCTCCATGTAGTTCTTAGTGCATCTGGATCCATAGGACAACCTGGTTTTGCTACCATTTGGGCTGGATTTTGGTGTGTTACAGGCACACGAGCAACTGTGATCGGCGCATTCTACTGCAGAATCTGCCTGGTGGAACGTGGCAGGAGCATCCTGTTCACATAAGTGTTTATCACCATTGTTTTCCAGTTCCGAGTCGCAGTCGCTCTCCTGGGATCCTTCTGAGGTTTCTTCATCTGAATGACATTGGAACTGCCATGTTGGTAGATTTTTTATGTAATCTGTTGGGATCAGAGGACGAAGCCATAAATCGGGAAACGCTAACCTCTCGAGAAACAGGTCTGGGTCTTCATCCCAATCGGAGTCCATGGGAAAATGGTTGATCAAACCAAATGGGGTGGAACAGGTAGCTTCTAACCCAGTCCCAAAGCTGGACAACCACTCCCAATTGTTGGCCTTTCCCTCTTTCTTCCTTTTCCTTTTACCTCCGCCCTTTTTCTTTCCTAAATTAATCCCAATGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAAGGGGTTTCACTGG