ORFeome > rnf114 ORF1 – XORFeome v1.0

rnf114 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rnf114
Gene ID: 982950
Gene Page ID: 982943
ORF Xenbase ID: 17293683

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC081234
Original XGC clone length: 381

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ839763
dbEST ID: 79657465
Trimmed Sequence: ATGAGAGAGCACTTGGCCGCTTGTTCAAAATATGAAAAATATGTCATGAATGGGATTAAGTCTGTCAAGATGGGCAAGCCCCAGGAAGCTGGTGATGTCCCAAACCGCTTCACCTTTACCTGCCCCTACTGCCAGGAACATAACCTCTCTCAGGAAGGGTTAGTGGATCATTGCAAGAGGTTACACATGATGGATCCAACTCCTGTGGTTTGCCCAATCTGTGCCTCCATGCCATGGGGAGATCCAGCTTACAGGAGCGCCAACTTCATAGAGCACATTAATCGTAGACATCGCTTCTCCTATGACACCTTTGTGGATTACAGCGCAGACGAAGAAGCCATGATAAACGAAGCATTAGTGCGTTCTGTTTCGGACAACTT
Full Trace Sequence: CTCGCGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGAGAGCACTTGGCCGCTTGTTCAAAATATGAAAAATATGTCATGAATGGGATTAAGTCTGTCAAGATGGGCAAGCCCCAGGAAGCTGGTGATGTCCCAAACCGCTTCACCTTTACCTGCCCCTACTGCCAGGAACATAACCTCTCTCAGGAAGGGTTAGTGGATCATTGCAAGAGGTTACACATGATGGATCCAACTCCTGTGGTTTGCCCAATCTGTGCCTCCATGCCATGGGGAGATCCAGCTTACAGGAGCGCCAACTTCATAGAGCACATTAATCGTAGACATCGCTTCTCCTATGACACCTTTGTGGATTACAGCGCAGACGAAGAAGCCATGATAAACGAAGCATTAGTGCGTTCTGTTTCGGACAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAAAAAAAAAACAAGTCACAAACATTAAAATGTTACATCGAAACCCCGGGGAAAAAAAACCAAAGCTCCTCCCCACCAGGGGCAAAAAAAATTCCCTTTGGTTATTGGAAATCCCCCTCCCCCGGAAAAACCCCGGGGGGGGATTAAAAGGTTGTTAAAACGCTTGGCGCGGCCCGGCTGTGGGCCAAAAAAAAACAAAAAACCGGGGGGGAAAAAGGGGAAGGGAGGGCTCCCCGCGCCCGGTATGGATTATTTTTTTTTGGGTGGTTTTTTTTTTCTCCAAACCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGAGAGCACTTGGCCGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839762
dbEST ID: 79657464
Trimmed Sequence: GTTGTCCGAAACAGAACGCACTAATGCTTCGTTTATCATGGCTTCTTCGTCTGCGCTGTAATCCACAAAGGTGTCATAGGAGAAGCGATGTCTACGATTAATGTGCTCTATGAAGTTGGCGCTCCTGTAAGCTGGATCTCCCCATGGCATGGAGGCACAGATTGGGCAAACCACAGGAGTTGGATCCATCATGTGTAACCTCTTGCAATGATCCACTAACCCTTCCTGAGAGAGGTTATGTTCCTGGCAGTAGGGGCAGGTAAAGGTGAAGCGGTTTGGGACATCACCAGCTTCCTGGGGCTTGCCCATCTTGACAGACTTAATCCCATTCATGACATATTTTTCATATTTTGAACAAGCGGCCAAGTGCTCTCTCATGG
Full Trace Sequence: GACGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGTCCGAAACAGAACGCACTAATGCTTCGTTTATCATGGCTTCTTCGTCTGCGCTGTAATCCACAAAGGTGTCATAGGAGAAGCGATGTCTACGATTAATGTGCTCTATGAAGTTGGCGCTCCTGTAAGCTGGATCTCCCCATGGCATGGAGGCACAGATTGGGCAAACCACAGGAGTTGGATCCATCATGTGTAACCTCTTGCAATGATCCACTAACCCTTCCTGAGAGAGGTTATGTTCCTGGCAGTAGGGGCAGGTAAAGGTGAAGCGGTTTGGGACATCACCAGCTTCCTGGGGCTTGCCCATCTTGACAGACTTAATCCCATTCATGACATATTTTTCATATTTTGAACAAGCGGCCAAGTGCTCTCTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCAAGCTAAATACTGGACGTCATTTTACACTCGTGGGACTGGGGGACTCAAAGCCAGAACTGCCCTGTAAAAAAGGGTCTCGTGTTATCCCATTGGTAAAGTAAAAGCTCTCATGAAAAAAACAACCCCCGTGGGGAGGTTTCACTGTGTTAGAGAGTGGTCCGGAGGGGAAAGGTGGCGCCCTNGTTGCGGAGACGGGGTGTGGAACTTTCTTGGAGTTTGGGGGGTTTTGGAGATGGTTTTTTGGCGCCTCTCCCCTCTTTGGCGACGAAAAACAACAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGTCCGAAACAGAACGCACTA