ORFeome > rnf182 ORF1 – XORFeome v1.0

rnf182 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rnf182
Gene ID: 1009196
Gene Page ID: 1009191
ORF Xenbase ID: 17293797

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078617
Original XGC clone length: 741

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ839860
dbEST ID: 79657562
Trimmed Sequence: ATGACAGGCCAGCTAACTGAAGATAATTCTGAGTCTCCCAATCTGAACTCTGAAGAGCTTGAATGTAAGATCTGCTACAACCGTTACAATCTGAGGCAGAGGAAACCAAAGGTACTTGGCTGTTGTCACAGAGTATGTGCCAAATGCCTTTACAAACTGGTGGACTGTGGAGAATCCGCACAATGTGTTATTGTGTGCCCTTTCTGCAGATTTGAGACCCGTTTGCCTGAGGATGAAGTCAGCAGCCTTCCAGATGACAATAATATATTACTGAACTTGGCATGTGGTGGAAGAGGGAAATGTGTTGGGGACAACCCAACAGAGCTGCTTCTGACCCCAAAACGTCTGTCAACTCTTGTCACCCCATCCCACACCTCTACCAATTGCCTTGTCATTACCATCATGGAGGTCCAGAGGGAAAGCTCACCTGCTTTGAATACTACTCCTGTGGTAGAATTTTACCGGCCTTCNCATTATGACCCAGTTTCAATACCTCAAAACTGGACAGTGTGGAACTGCACTTCCCTGATCTGCCAAACCTCANTGCGTGTGTTTGTTTGGTTGTTAGGGTTACTTTACTTCAGCTCCCTACCCTTAGGGATCTATTTGCTGGTGTTCAAAAAGTCACCCCTTGTGGGTGTCTTTTTTCGCCCTTGTTCCATCTAAGCCCTGTTATTCTCAGGGTAAATGGCCTTTTTTCAAGGTGTTGTGTCTTGAATTTTTTTAAACTGTTATTTCCCCGTTCTTTGCCCCACTTTTTTTTTTACAAAATTTTGGATTTATTAAAAAAAAAAATTTTTTTTTTTTCTATTTTTTTTGTC
Full Trace Sequence: TCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAGGCCAGCTAACTGAAGATAATTCTGAGTCTCCCAATCTGAACTCTGAAGAGCTTGAATGTAAGATCTGCTACAACCGTTACAATCTGAGGCAGAGGAAACCAAAGGTACTTGGCTGTTGTCACAGAGTATGTGCCAAATGCCTTTACAAACTGGTGGACTGTGGAGAATCCGCACAATGTGTTATTGTGTGCCCTTTCTGCAGATTTGAGACCCGTTTGCCTGAGGATGAAGTCAGCAGCCTTCCAGATGACAATAATATATTACTGAACTTGGCATGTGGTGGAAGAGGGAAATGTGTTGGGGACAACCCAACAGAGCTGCTTCTGACCCCAAAACGTCTGTCAACTCTTGTCACCCCATCCCACACCTCTACCAATTGCCTTGTCATTACCATCATGGAGGTCCAGAGGGAAAGCTCACCTGCTTTGAATACTACTCCTGTGGTAGAATTTTACCGGCCTTCNCATTATGACCCAGTTTCAATACCTCAAAACTGGACAGTGTGGAACTGCACTTCCCTGATCTGCCAAACCTCANTGCGTGTGTTTGTTTGGTTGTTAGGGTTACTTTACTTCAGCTCCCTACCCTTAGGGATCTATTTGCTGGTGTTCAAAAAGTCACCCCTTGTGGGTGTCTTTTTTCGCCCTTGTTCCATCTAAGCCCTGTTATTCTCAGGGTAAATGGCCTTTTTTCAAGGTGTTGTGTCTTGAATTTTTTTAAACTGTTATTTCCCCGTTCTTTGCCCCACTTTTTTTTTTACAAAATTTTGGATTTATTAAAAAAAAAAATTTTTTTTTTTTCTATTTTTTTTGTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAGGCCAGCTAACTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839859
dbEST ID: 79657561
Trimmed Sequence: AGACGTTGACATACAGTCTAAAAATTCATGACACACACACTGACAAAAGCCATATACCATGAGAATAACAAGGCTAGATGGAACAAGGCTGACAAAGACAACCCCAAGGGTGACTTTTTTTGACACCACCAAATAGATCCCTAAGGGTAGGGAGCTGAAATAAAGTAACCCTAACAACCAAACAAACACACGCACTGAGGTTTGGCAGATAACGGAAGTGCAGTTCCACACTGTCCAGTTTTGAGGTATTGAAACTGGGTCATAATTGGAAGGCCGGTAAAATTCTACCACAGGAGTAGTATTCAAAGCACGTGAGCTTTCCCTCTGGACCTCCCTGATGGTAATGACAAGGCAATTGGTAGAGGTGTGGGGATGGGGTGACAAGAGTTGACAGACATTTTGGGGTCACAAACACCTCTGTTGGGTTGTCCCCAACACATTTCCCTCTTCCACCACATGCCAAGTTCACTAATATATTATTGTCATCTGGAAAGCTGCTGACATCATCCTCACGCAAACAGGTCTCACATCTGCACAAAGGGCACACAATATCACATTGTGCGGATTCTCCACAGTCCACCACTTTGTAAAGGCATTTGGCACATACTCTCTGACACCACCCAGTACCTCTGGGTTCCTCTGCTGTCCAATAGTACGGGTTGTACAAATCATACATTCCAGCTCTTCCCAGATCCAAATTGGAAAACTCAAAAATATACTTCACTTAACTTGCCCTGTTCAGGGGCCCCACTTTTTTTTTTTGCGAAATTTGGCGTATT
Full Trace Sequence: GAAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGACGTTGACATACAGTCTAAAAATTCATGACACACACACTGACAAAAGCCATATACCATGAGAATAACAAGGCTAGATGGAACAAGGCTGACAAAGACAACCCCAAGGGTGACTTTTTTTGACACCACCAAATAGATCCCTAAGGGTAGGGAGCTGAAATAAAGTAACCCTAACAACCAAACAAACACACGCACTGAGGTTTGGCAGATAACGGAAGTGCAGTTCCACACTGTCCAGTTTTGAGGTATTGAAACTGGGTCATAATTGGAAGGCCGGTAAAATTCTACCACAGGAGTAGTATTCAAAGCACGTGAGCTTTCCCTCTGGACCTCCCTGATGGTAATGACAAGGCAATTGGTAGAGGTGTGGGGATGGGGTGACAAGAGTTGACAGACATTTTGGGGTCACAAACACCTCTGTTGGGTTGTCCCCAACACATTTCCCTCTTCCACCACATGCCAAGTTCACTAATATATTATTGTCATCTGGAAAGCTGCTGACATCATCCTCACGCAAACAGGTCTCACATCTGCACAAAGGGCACACAATATCACATTGTGCGGATTCTCCACAGTCCACCACTTTGTAAAGGCATTTGGCACATACTCTCTGACACCACCCAGTACCTCTGGGTTCCTCTGCTGTCCAATAGTACGGGTTGTACAAATCATACATTCCAGCTCTTCCCAGATCCAAATTGGAAAACTCAAAAATATACTTCACTTAACTTGCCCTGTTCAGGGGCCCCACTTTTTTTTTTTGCGAAATTTGGCGTATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACGTTGACATACAGTCTAAAAA