ORFeome > rnf208 ORF1 – XORFeome v1.0

rnf208 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rnf208
Gene ID: 1010183
Gene Page ID: 1010179
ORF Xenbase ID: 17293809

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC123250
Original XGC clone length: 708

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ838793
dbEST ID: 79656495
Trimmed Sequence: ATGGAGGCCATGAAGATCATCCAGGCCGAGAAGTTCTCAGAGTGTCAGAACTCTCAGCCTCGGTACTGCCCCCCATCTCGGAGGGAACCTCCGCTGGTTGCCAAACGGGCCTGGCCATCTGATTCCGAGATCATTGTCAACCAGGCGTGCGGAGACATGCCCACTCTGGAAAACAACCCAAACACGATGGGGCTTCCAACTAGGACACCACCTCCTCCACGAAGGGAAAAGATCTATCCTGGCCAACGGAAACTGAGCACAGATATTTGTTACCATCGCAAGACCCCTTCTGATGAAGTCATTGTGAACCAGTATGTGCTGCACCCATCCACCCCTTGTGAGCCCTTAGAATGCCCCACCTGCGGGCACATGTACAATTTCACCAACAAGCGGCCTCGGATCTTGTCCTGCCTCCATTCTGTGTGCGAGGAGTGTCTGCAGATCCTCTACGAGTCCTGCCCCCAGTACAAATTCATTTCCTGCCGCCCCTGCGAGCGGGAGACTGTGCTCTTTACTGAATATGGGCTGGCGGCTCTCGCTGTAACACCAACATCCTCAACCGGCTCCGGACAGAGGCCCTTTCACCTATCCAGTGCAGTGGACGCATGACACAGACCGCAACCTGCTGCCGACCTTTCCCCCATACTGCCGGGCGGCCCGGTCCTGCGTGTTCCGAATCCCGTTGTCTTCCTGTTACCTCTGTTGTTCACCGTTCTTTTTCGAGTTTTGGGTATTATTTAGAACACTTTTCCTTATAATTTTGTTGTGCTAGTGTAACGGTTTACCTTAAATGTCTCCGAAATAAA
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGCCATGAAGATCATCCAGGCCGAGAAGTTCTCAGAGTGTCAGAACTCTCAGCCTCGGTACTGCCCCCCATCTCGGAGGGAACCTCCGCTGGTTGCCAAACGGGCCTGGCCATCTGATTCCGAGATCATTGTCAACCAGGCGTGCGGAGACATGCCCACTCTGGAAAACAACCCAAACACGATGGGGCTTCCAACTAGGACACCACCTCCTCCACGAAGGGAAAAGATCTATCCTGGCCAACGGAAACTGAGCACAGATATTTGTTACCATCGCAAGACCCCTTCTGATGAAGTCATTGTGAACCAGTATGTGCTGCACCCATCCACCCCTTGTGAGCCCTTAGAATGCCCCACCTGCGGGCACATGTACAATTTCACCAACAAGCGGCCTCGGATCTTGTCCTGCCTCCATTCTGTGTGCGAGGAGTGTCTGCAGATCCTCTACGAGTCCTGCCCCCAGTACAAATTCATTTCCTGCCGCCCCTGCGAGCGGGAGACTGTGCTCTTTACTGAATATGGGCTGGCGGCTCTCGCTGTAACACCAACATCCTCAACCGGCTCCGGACAGAGGCCCTTTCACCTATCCAGTGCAGTGGACGCATGACACAGACCGCAACCTGCTGCCGACCTTTCCCCCATACTGCCGGGCGGCCCGGTCCTGCGTGTTCCGAATCCCGTTGTCTTCCTGTTACCTCTGTTGTTCACCGTTCTTTTTCGAGTTTTGGGTATTATTTAGAACACTTTTCCTTATAATTTTGTTGTGCTAGTGTAACGGTTTACCTTAAATGTCTCCGAAATAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGCCATGAAGATCATCCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838792
dbEST ID: 79656494
Trimmed Sequence: CATGATGGTACAGGAAGACAACGGGTTTCTGACGTGGCAGGTACAGGCCGCCCCGCAGTATTGGCGGAAGGTCTGGTAGCAGCTGCGGTCTGTGTCACTGCTCCACTGCACCTGATTGGCCGATAGGGCCTCGGTCGGGAGCCGGTTGAGGATGCTGGTGTTGACAGCGAGGGCCGCCAGCCCATAGTCAGTAAAGAGCACAGTCTCCCGCTTGCAGGTGGGGCAGGAAATGAATTTGTACTTGGGGCAGGACTCGTAGAGGATCTGCAGACACTCCTCGCACACAGAATGGAGGCAGGACAAGATCCGAGGCCGCTTGTTGGTGAAATTGTACATGTGCCCGCAGGTGGGGCATTCTAAGGGCTCACAAGGGGTGGATGGGTGCAGCACATACTGGTTCACAATGACTTCATCAGAAGGGGTCTTGCGATGGTAACGAATATCTGTGCTCAGTTTCCGTTGGCCAAGATAGATCTTTTCCCTTCGTGGAGGAGGTAGTGTCCTAGTTGGAAACCCCATCGTGTTTTGGTTGTTTGTCCAAGTGCACATGTCGCCCCACTCCCTGCTTAAAAGGATCTTGGAATCAAAATGACCACTCCCGTTTGGCACCGGGCGGGAGGTCCCGCCAAGAATCGGGGCAATGGCGGGGGGTGAGAGTTCGGGAGGGCCTAGAGGATACCCGGCCGGGGAAAATCATTAGGGGGCGCCGAATATGGCGCGAGCGTGGGGTGGGGTGTGGGGTTAGGTATTTAAGGAGA
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGATGGTACAGGAAGACAACGGGTTTCTGACGTGGCAGGTACAGGCCGCCCCGCAGTATTGGCGGAAGGTCTGGTAGCAGCTGCGGTCTGTGTCACTGCTCCACTGCACCTGATTGGCCGATAGGGCCTCGGTCGGGAGCCGGTTGAGGATGCTGGTGTTGACAGCGAGGGCCGCCAGCCCATAGTCAGTAAAGAGCACAGTCTCCCGCTTGCAGGTGGGGCAGGAAATGAATTTGTACTTGGGGCAGGACTCGTAGAGGATCTGCAGACACTCCTCGCACACAGAATGGAGGCAGGACAAGATCCGAGGCCGCTTGTTGGTGAAATTGTACATGTGCCCGCAGGTGGGGCATTCTAAGGGCTCACAAGGGGTGGATGGGTGCAGCACATACTGGTTCACAATGACTTCATCAGAAGGGGTCTTGCGATGGTAACGAATATCTGTGCTCAGTTTCCGTTGGCCAAGATAGATCTTTTCCCTTCGTGGAGGAGGTAGTGTCCTAGTTGGAAACCCCATCGTGTTTTGGTTGTTTGTCCAAGTGCACATGTCGCCCCACTCCCTGCTTAAAAGGATCTTGGAATCAAAATGACCACTCCCGTTTGGCACCGGGCGGGAGGTCCCGCCAAGAATCGGGGCAATGGCGGGGGGTGAGAGTTCGGGAGGGCCTAGAGGATACCCGGCCGGGGAAAATCATTAGGGGGCGCCGAATATGGCGCGAGCGTGGGGTGGGGTGTGGGGTTAGGTATTTAAGGAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGATGGTACAGGAAGACAA