ORFeome > rnf217 ORF1 – XORFeome v1.0

rnf217 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rnf217
Gene ID: 987826
Gene Page ID: 987823
ORF Xenbase ID: 17293815

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC099015
Original XGC clone length: 849

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ838457
dbEST ID: 79656159
Trimmed Sequence: ATGAGCTGTCGGGTGTGCTTGGAGGACAGATCTATCAAACCCCTGCCCTGCTGTAAAAAGCCCGTCTGTGATGAATGCCTCAAGAGATACCTGAGCTCCCAGGTGCAGTTAGGACAAGCAGAAATCCAATGCCCAATAACTGAGTGCAATAAACATCTGGATGAATCCACCATTTTGTATAGCCTGCCACATGATGACATCATCAAGTATAAATACTTCCTGGAACTTAGCCGTATGGACTCAAGCACCAAGCCCTGCCCGCAGTGCAAGCACTTTACAACATTCAAGCGTAAAACCCACATACCAAACCCCACCAAATCTGAGAACAAGTTAAAAATACAGTGCCCATCTTGCCAATTTATTTGGTGTTTTAGGTGCCATGCTCCCTGGCATGAAGGAGTTAACTGCAGAGAGTACAAGAAAGGGGACAAACTTTTGCGTCACTGGGCCAATGAAATTGAACATGGACAGAGAAATGCTCAAAAATGTCCACGATGTAAGGTCCATATTCAAAGAACCGAAGGTTGTGACCACATGACATGTTCTCAATGTAACACTAATTTTTGTTATCGCTGTGGGGAGAGATACCGTCAGCTGCGTTTTTTTGGTGATCACACATCAGACCTCAGTATATTTGGATGCAAATACCGCTACCTCCCACAGAGACCCCATGTAAAGAAATTAGTACGAGGGCTCTGTTTGTGCTGGAAAACTTCTCCATTGCACACT
Full Trace Sequence: GGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCTGTCGGGTGTGCTTGGAGGACAGATCTATCAAACCCCTGCCCTGCTGTAAAAAGCCCGTCTGTGATGAATGCCTCAAGAGATACCTGAGCTCCCAGGTGCAGTTAGGACAAGCAGAAATCCAATGCCCAATAACTGAGTGCAATAAACATCTGGATGAATCCACCATTTTGTATAGCCTGCCACATGATGACATCATCAAGTATAAATACTTCCTGGAACTTAGCCGTATGGACTCAAGCACCAAGCCCTGCCCGCAGTGCAAGCACTTTACAACATTCAAGCGTAAAACCCACATACCAAACCCCACCAAATCTGAGAACAAGTTAAAAATACAGTGCCCATCTTGCCAATTTATTTGGTGTTTTAGGTGCCATGCTCCCTGGCATGAAGGAGTTAACTGCAGAGAGTACAAGAAAGGGGACAAACTTTTGCGTCACTGGGCCAATGAAATTGAACATGGACAGAGAAATGCTCAAAAATGTCCACGATGTAAGGTCCATATTCAAAGAACCGAAGGTTGTGACCACATGACATGTTCTCAATGTAACACTAATTTTTGTTATCGCTGTGGGGAGAGATACCGTCAGCTGCGTTTTTTTGGTGATCACACATCAGACCTCAGTATATTTGGATGCAAATACCGCTACCTCCCACAGAGACCCCATGTAAAGAAATTAGTACGAGGGCTCTGTTTGTGCTGGAAAACTTCTCCATTGCACACT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTGTCGGGTGTGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838456
dbEST ID: 79656158
Trimmed Sequence: CCAGGGCATACCTGTCCGTGTCCTTTTCCGTTGTTTTTTACAGAGACAATAGATAGGCAAACCAAATAACCCTATTACAACTGCTAAGGCTCCAAGTACCAAACCCAAAACTATGAGAAGTGGTGCAATGAGAAGTTTTCCAGCACAAACAGAGCCTCGTACTAATCTCCTTACATGGGGTCTCTCTGGGAGGTAGCGGTATTTGCATCCAAATATACTGAGGTTTGATGTGTGATCACCAAAAAAACGCAGCTGACGGTATCTCTCCCCACAGCGATAACAAAAATTAATGTTACATTGAGAACATGTCATGTGGTCACAACCTTCGGTTCGTTGAATATGGACCTTACATCGTGGACATTTTTGAGCATTTCTCTGTCCGTGTTCGATTTCATTGTGCCGGGGACGCGGAAGTTTATCCCCTTTCTTGTATTCTCTGCAGTGGACTCCTTCCTGCGGGGGAGCAGGGGGGGGAGAGGGGGGGGGAAATTGGCAAGAGGAGAACTGGATTTTGATCTTTTTCGCATATTGGGGGGGGGGGGGGAGCTGGTTTGGGTGTGTTTGAGGATGAAAATTCCACAAAAGAGGAAACGGGGGGGGGGGAGATGACTGGGTGCTGGGGGGAGGGGGGGGGGGGAGGGGGGAGAAAAAAAGTGGGGGGGGGGGGGGGGGGAAGGAAGGGGAAAGGGGAGAGATGGGGGGGGGATATTTGGGGGGGGGGGAGGAGAGACC
Full Trace Sequence: GGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCAGGGCATACCTGTCCGTGTCCTTTTCCGTTGTTTTTTACAGAGACAATAGATAGGCAAACCAAATAACCCTATTACAACTGCTAAGGCTCCAAGTACCAAACCCAAAACTATGAGAAGTGGTGCAATGAGAAGTTTTCCAGCACAAACAGAGCCTCGTACTAATCTCCTTACATGGGGTCTCTCTGGGAGGTAGCGGTATTTGCATCCAAATATACTGAGGTTTGATGTGTGATCACCAAAAAAACGCAGCTGACGGTATCTCTCCCCACAGCGATAACAAAAATTAATGTTACATTGAGAACATGTCATGTGGTCACAACCTTCGGTTCGTTGAATATGGACCTTACATCGTGGACATTTTTGAGCATTTCTCTGTCCGTGTTCGATTTCATTGTGCCGGGGACGCGGAAGTTTATCCCCTTTCTTGTATTCTCTGCAGTGGACTCCTTCCTGCGGGGGAGCAGGGGGGGGAGAGGGGGGGGGAAATTGGCAAGAGGAGAACTGGATTTTGATCTTTTTCGCATATTGGGGGGGGGGGGGGAGCTGGTTTGGGTGTGTTTGAGGATGAAAATTCCACAAAAGAGGAAACGGGGGGGGGGGAGATGACTGGGTGCTGGGGGGAGGGGGGGGGGGGAGGGGGGAGAAAAAAAGTGGGGGGGGGGGGGGGGGGAAGGAAGGGGAAAGGGGAGAGATGGGGGGGGGATATTTGGGGGGGGGGGAGGAGAGACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAGGGCATACCTGTCCGT