ORFeome > rnf25 ORF1 – XORFeome v1.0

rnf25 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rnf25
Gene ID: 994722
Gene Page ID: 994717
ORF Xenbase ID: 17293839

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC141753
Original XGC clone length: 1134

Human orthology & disease relationships

NCBI Entrez ID: 64320
Ensembl gene IDs: ENSG00000163481
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 214150,216400,270200,300000,307030,601675

Library Location

Plate ID: GDExl11091
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ838865
dbEST ID: 79656567
Trimmed Sequence: ATGGCGGCTGAGGCAGCAGAGGAGGAAGAATCCCTGATTCAGGAGCTGCAAGTGCTAGAATCTATTTACCCTGGCGAACTCCAGATCTCCCAGGGAGAGAGAGTGGTTCTTGGCATTACCCTCCACCCAGCCACTGGCCACGATGAAGAAACACAGTATGTCAGAATTACCCTGGAGCTGTCTCTTCCTCCTAAGTATCCTGCAGAGGTACCAGAGATCAGTGTGAAAAACCCCCGAGGTCTGTGTGATGAACAGATAAATAGCATTGTCAGCTCTCTGCGCATTATAGCTGAGCAAGGTGTCGGGTGCCCGATTCTCTATGAGATGATTGAGAAAGGGAAGGAGATGCTGACAGCCAGTAATATCCCCCGTGGCCATTGTGTCATCTGCTTATATGACTTCAAGGAGGGGGATTCACTGACCAAGACGCCATGTTTCCACCATTTCCATTCGTACTGCCTGGGTCGGTATGCAGAGCACAGTACAGAACAGAAGCGGTCGGAGGAGCTTTCCATATTGTGCCCTGTTTGTCGTGGGGATGTGACCTGGTGACGTCCGCCAACTACAAGCCACTCCACCCCCCTTTGCACCCGAAGGAGACCTATTACCCAAATCGTGCCCCCCCGAGAAAACAGAAAGAACCTTCCCCGAATTTACCAGGGTTCACTCTCCTAAGGGAGGGCGTAAGTGGACATTTATGGGTGAAAAGAAATTCCTTTTTTTTTTTGTTTTCAAAAAGCCGCCGCCGCACATTTTTGAATTTGTTCCCTTTGACGCATAACCCTATATAATTGAAGTTACCAGTTCGTGGCCGCCCCGAGGGGG
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTGAGGCAGCAGAGGAGGAAGAATCCCTGATTCAGGAGCTGCAAGTGCTAGAATCTATTTACCCTGGCGAACTCCAGATCTCCCAGGGAGAGAGAGTGGTTCTTGGCATTACCCTCCACCCAGCCACTGGCCACGATGAAGAAACACAGTATGTCAGAATTACCCTGGAGCTGTCTCTTCCTCCTAAGTATCCTGCAGAGGTACCAGAGATCAGTGTGAAAAACCCCCGAGGTCTGTGTGATGAACAGATAAATAGCATTGTCAGCTCTCTGCGCATTATAGCTGAGCAAGGTGTCGGGTGCCCGATTCTCTATGAGATGATTGAGAAAGGGAAGGAGATGCTGACAGCCAGTAATATCCCCCGTGGCCATTGTGTCATCTGCTTATATGACTTCAAGGAGGGGGATTCACTGACCAAGACGCCATGTTTCCACCATTTCCATTCGTACTGCCTGGGTCGGTATGCAGAGCACAGTACAGAACAGAAGCGGTCGGAGGAGCTTTCCATATTGTGCCCTGTTTGTCGTGGGGATGTGACCTGGTGACGTCCGCCAACTACAAGCCACTCCACCCCCCTTTGCACCCGAAGGAGACCTATTACCCAAATCGTGCCCCCCCGAGAAAACAGAAAGAACCTTCCCCGAATTTACCAGGGTTCACTCTCCTAAGGGAGGGCGTAAGTGGACATTTATGGGTGAAAAGAAATTCCTTTTTTTTTTTGTTTTCAAAAAGCCGCCGCCGCACATTTTTGAATTTGTTCCCTTTGACGCATAACCCTATATAATTGAAGTTACCAGTTCGTGGCCGCCCCGAGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTGAGGCAGCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838864
dbEST ID: 79656566
Trimmed Sequence: AAGGGGATTGCTTTTCAAATACTGTTCTCCTCTGCCTCTGGGAGGCAGCTGGACCATTGCACCACTCCTAAAATTGCGACCCCTGTAGTTCCCCCGCCCTGGCACTTCATGGCCTCTGCTTATGGCTGGTTTACCATCCCCGCTTAAGTCGTATCTTTCAGGTCTGCCTCTGCCGTGGGGCTTTCTCCCTCTTCCATGGTACATATGGCTGTTAGCATTATGGTCAGTATGTACAGGCCGGTAGTGCTGATTCCGATATCCTTGTCTTTGCCGGTCAGGGTGGCCTCTGGAGGAGGGAGGTTTGGGCTCCACTGGAGGTGGTGGGGGCTCTACCCCTGGCTGCAGTGACTGGACATCATCATCAGGTTGTGGCTCAAGGACAGTATCAAATTGTGGCGGCGGCTCTTGGATGCTGATGAAAAAGCGATTCTTTTCCTCCTCAATGTCAATTATGCCCCCTTTATCGATCTGAACCTGGTAAATCCGGCGCAACTCCTTCTGTTTCTTTATGGTTGCACGATCTGGTGTATAGGTCTCCTCTGCGTGCAAGGATGGTGGAGCCGCCTGATACTTTGCGACTTCACAAGTACATCGTCCCAAACAAACAGGGAGAGGATGGAAAGACTCGGCGACCGCGTCCGTTTCTGGATGTTCTCTTCTTTCCTCTCCTTCCCATACCAAACACACAATGTTGGAAAGGGTGGGGGTTCTTGCTTCCGTGGAGTCCCCGTGTCTTTTTGATTTCTATTTTACCCCTA
Full Trace Sequence: GGCAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGGGGATTGCTTTTCAAATACTGTTCTCCTCTGCCTCTGGGAGGCAGCTGGACCATTGCACCACTCCTAAAATTGCGACCCCTGTAGTTCCCCCGCCCTGGCACTTCATGGCCTCTGCTTATGGCTGGTTTACCATCCCCGCTTAAGTCGTATCTTTCAGGTCTGCCTCTGCCGTGGGGCTTTCTCCCTCTTCCATGGTACATATGGCTGTTAGCATTATGGTCAGTATGTACAGGCCGGTAGTGCTGATTCCGATATCCTTGTCTTTGCCGGTCAGGGTGGCCTCTGGAGGAGGGAGGTTTGGGCTCCACTGGAGGTGGTGGGGGCTCTACCCCTGGCTGCAGTGACTGGACATCATCATCAGGTTGTGGCTCAAGGACAGTATCAAATTGTGGCGGCGGCTCTTGGATGCTGATGAAAAAGCGATTCTTTTCCTCCTCAATGTCAATTATGCCCCCTTTATCGATCTGAACCTGGTAAATCCGGCGCAACTCCTTCTGTTTCTTTATGGTTGCACGATCTGGTGTATAGGTCTCCTCTGCGTGCAAGGATGGTGGAGCCGCCTGATACTTTGCGACTTCACAAGTACATCGTCCCAAACAAACAGGGAGAGGATGGAAAGACTCGGCGACCGCGTCCGTTTCTGGATGTTCTCTTCTTTCCTCTCCTTCCCATACCAAACACACAATGTTGGAAAGGGTGGGGGTTCTTGCTTCCGTGGAGTCCCCGTGTCTTTTTGATTTCTATTTTACCCCTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGGGGATTGCTTTTCAAATACTG