ORFeome > rnf31 ORF1 – XORFeome v1.0

rnf31 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rnf31
Gene ID: 968737
Gene Page ID: 968730
ORF Xenbase ID: 17293851

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC126008
Original XGC clone length: 3135

Human orthology & disease relationships

NCBI Entrez ID: 55072
Ensembl gene IDs: ENSG00000092098
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 142680,180849,209950,245590

Library Location

Plate ID: GDExl11083
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ837308
dbEST ID: 79655010
Trimmed Sequence: ATGGCAGAACATCATATAAGGAATACCTTGGAAACCCGTATTAACGCTCGGTCTCTGGATCCATGTGTTCTCTATGATCTGGCTGAGACAGTGAATGTGTGTCAACGCTACCTTCCTTTATTGCCTCTACAAGATCTCAATGAGGATGAGGCCAGCTATAAAGAGCGTCTCCTGGGGGTTCTAATGTCGGAGGTTCCATTGAGTCTGAACATTCCACGGAAGCAGCATTT
Full Trace Sequence: GGCTCGAGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGAACATCATATAAGGAATACCTTGGAAACCCGTATTAACGCTCGGTCTCTGGATCCATGTGTTCTCTATGATCTGGCTGAGACAGTGAATGTGTGTCAACGCTACCTTCCTTTATTGCCTCTACAAGATCTCAATGAGGATGAGGCCAGCTATAAAGAGCGTCTCCTGGGGGTTCTAATGTCGGAGGTTCCATTGAGTCTGAACATTCCACGGAAGCAGCATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTAGAAAGAGAACAAGAAAAAAATATATCATCATGCCTCCTCTAGACCAACCAGGACAGAAATGAAACGACTTCTCTGCTAACCTGGGTTGCCGGGTGACGCGCACCTGTGTAAACGGATGATGGCACGAGCCCAATGGATATAAGCGTGATCGGTTCGTAAGCTGTAATGCATAGCGGGAAAACGCTCACAGAAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAAAGGCGGAATGGCCGGTTTTTCTGGCTTGTTATGGCTGGTTTTTATTTGGGTTACGTCATATGCCCCGGGGCATCCAAGCCCGCAACGGGGTTACCCTTTTGGTTCGGATTTTTTTTTTTTTATATTATTTTTCTCTAGTGTTAACCAAACAAGGGGCCCCCCCCCCCCAAAAAACCACCACTAAAAACAATAAAGGAAGGGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAACATCATATAAGGAAT

Sequences - 3ʹ (reverse) EST

Accession: JZ837307
dbEST ID: 79655009
Trimmed Sequence: ATGCTGCTTCCGTGGAATGTTCAGACTCAATGGAACCTCCGACATTAGAACCCCCAGGAGACGCTCTTTATAGCTGGCCTCATCCTCATTGAGATCTTGTAGAGGCAATAAAGGAAGGTAGCGTTGACACACATTCACTGTCTCAGCCAGATCATAGAGAACACATGGATCCAGAGACCGAGCGTTAATACGGCTTACAAGGTATTCCTTATATGATGTTCTGCCATGG
Full Trace Sequence: GGCAAAATGCTTATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGCTGCTTCCGTGGAATGTTCAGACTCAATGGAACCTCCGACATTAGAACCCCCAGGAGACGCTCTTTATAGCTGGCCTCATCCTCATTGAGATCTTGTAGAGGCAATAAAGGAAGGTAGCGTTGACACACATTCACTGTCTCAGCCAGATCATAGAGAACACATGGATCCAGAGACCGAGCGTTAATACGGCTTACAAGGTATTCCTTATATGATGTTCTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGGAAACAATAAAGACAACCGTTATCACCAGGCCAGGCACCTGACAGGCATCGAAAAAATGAATCGACTTCTCTGCAAACTGAGGCTGTCGTGTGATGCAGATCTTGGAAACGGACGACCGCACGAACCCTGGGGACTTACCCTGGTTCGTTTCGGAAGTGTAATGCAAGAGCGTATGCGCTCACGCAACGGGTCCAAAACAAGACGAACGCAACGGTGTAAGCGCNCATCGGGCGTTTACATAGCTTAGTAAAACTGTTNTTTAGGGGNNNGGGGNGGCCCGGGNAGCAAGAAAGNNANNGNTANNCCGGGNGNNGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGCTGCTTCCGTGGAATGT