ORFeome > rom1 ORF1 – XORFeome v1.0

rom1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rom1
Gene ID: 962407
Gene Page ID: 962405
ORF Xenbase ID: 17293941

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054990
Original XGC clone length: 1038

Human orthology & disease relationships

NCBI Entrez ID: 6094
Ensembl gene IDs: ENSG00000149489
Directly associated (OMIM) disease MIM numbers: 608133
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ839521
dbEST ID: 79657223
Trimmed Sequence: ATGGTCCTCTTTAAGGCCAAATTTTCTTTCCAGAGGCGGGTGAAACTTGCACAAACTCTATGGCTTCTCTCCTGGCTCAGTGTCCTAGTAGGGTGCCTGACATTTGGAATGGGGATCTTTCTAAAGGTACAGCTCTGGATACACAATGAAGTGATGGAAATCACCTCAGCTCACGCTGTTCCTAACACGGTGATAACAGCAGGGTTAGTGGGAATACTCCTTGGTATTTATGCAGGGAAGGTCAGCCAGGCCTCTATGGATGTGACCAAGTACCAACGCTGGAAGTCTTTCATGATGCCCTTTTTCTTTTTGGCTATCCTGAGCTGTTTAGTATGCTTAGCTGCCCTAGTCCTCAGTGTGGCATTGAGGGGCACCTTAGAAGAATCACTTAAAATAGGGCTAAAGAACGCAATTCGATTTTATAAGGACACAGACACGCCTGGACGCTGCTATCAAAAGAGGAGCATGGACAAGCTGCAGATGGATTTCCAGTGCTGTGGAAACAACCACCCCAAAGACTGGTTTGAGGTGCAGTGGATAAGCAATCGTTATCTGGACTTCAGCTCTAANGAAGTCAAAGACCGTATAANAAGTAATGTGGATGGACGGTACCTGATGGACAGTGTCCCATTCAGCTGCTGTAATCCCAGCTCACCCCGGCCTTGCATCAAAATGCAGATCNACAATAACTCAGCCCATTACAGCTAACACTACCAAAGCGATGAGCTTAATATCTGGGTGAAGGGCTGCCAGAGAAGCGCTGTTAAACTACTACCCCTGG
Full Trace Sequence: GGCCCCAAATAATAGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTCCTCTTTAAGGCCAAATTTTCTTTCCAGAGGCGGGTGAAACTTGCACAAACTCTATGGCTTCTCTCCTGGCTCAGTGTCCTAGTAGGGTGCCTGACATTTGGAATGGGGATCTTTCTAAAGGTACAGCTCTGGATACACAATGAAGTGATGGAAATCACCTCAGCTCACGCTGTTCCTAACACGGTGATAACAGCAGGGTTAGTGGGAATACTCCTTGGTATTTATGCAGGGAAGGTCAGCCAGGCCTCTATGGATGTGACCAAGTACCAACGCTGGAAGTCTTTCATGATGCCCTTTTTCTTTTTGGCTATCCTGAGCTGTTTAGTATGCTTAGCTGCCCTAGTCCTCAGTGTGGCATTGAGGGGCACCTTAGAAGAATCACTTAAAATAGGGCTAAAGAACGCAATTCGATTTTATAAGGACACAGACACGCCTGGACGCTGCTATCAAAAGAGGAGCATGGACAAGCTGCAGATGGATTTCCAGTGCTGTGGAAACAACCACCCCAAAGACTGGTTTGAGGTGCAGTGGATAAGCAATCGTTATCTGGACTTCAGCTCTAANGAAGTCAAAGACCGTATAANAAGTAATGTGGATGGACGGTACCTGATGGACAGTGTCCCATTCAGCTGCTGTAATCCCAGCTCACCCCGGCCTTGCATCAAAATGCAGATCNACAATAACTCAGCCCATTACAGCTAACACTACCAAAGCGATGAGCTTAATATCTGGGTGAAGGGCTGCCAGAGAAGCGCTGTTAAACTACTACCCCTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTCCTCTTTAAGGCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839520
dbEST ID: 79657222
Trimmed Sequence: GCTGGCCGCCGCTGCTTCTCCACCTCCCTCTGCTGTCTCCACCTGATTTGACATGAAAAGACCTTTCATTTTCTCCAGGGTAGTGTTCATAGTTTCCGTTACTCCTTTCTCCAAAATAAAACCTTCTGTGTCTGCCTCCATATCATCAGGACCACTGATCTTGTCCATAGAGGTATGCAGATAGCGAAGGCTGACCAGCACAGAGGCCTGCAGAAGAAAAGACAGGGTAACTGCAGCCCCATTAGTTGCCATAATCCCAGTGTAGTAGCTTAACAGCGCCTCTCTGCAGCCCCTCACCCAGATATTAAGCTCATCGCTCTGGTAGTTGTAGCTGTAATGGGCTGAGTTATTGGTGATCTGCATTTGGATGCAAGGCCGGGGTGAGCTGGGATTACAGCAGCTGAATGGGACACTGTCCATCAGGTACCGTCCATCCACATTACTTTTTATACGGTCTTTGACTTCCTTAGAGCTGAAGTCCAGATAACGATTGCTTATCCACTGCACCTCAGACCATCTTTTGGGGGTGGTTGTTTCCACAGCAACTGGAGATCCATCTGCAGCTTGTCCATGCTCCTCCTTTTGATAGCAGCGTCCCAGGCGTGTCTGTGTCCCTTATAAAAACCCAATTTGGTTTCTTTACCCCTAATTTAAAGTGAATTCGTTCTAAGGGTGCCCCCTCCAATGGCCCCACTTAAGGAAAAAAAGGACAAC
Full Trace Sequence: GGAAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGGCCGCCGCTGCTTCTCCACCTCCCTCTGCTGTCTCCACCTGATTTGACATGAAAAGACCTTTCATTTTCTCCAGGGTAGTGTTCATAGTTTCCGTTACTCCTTTCTCCAAAATAAAACCTTCTGTGTCTGCCTCCATATCATCAGGACCACTGATCTTGTCCATAGAGGTATGCAGATAGCGAAGGCTGACCAGCACAGAGGCCTGCAGAAGAAAAGACAGGGTAACTGCAGCCCCATTAGTTGCCATAATCCCAGTGTAGTAGCTTAACAGCGCCTCTCTGCAGCCCCTCACCCAGATATTAAGCTCATCGCTCTGGTAGTTGTAGCTGTAATGGGCTGAGTTATTGGTGATCTGCATTTGGATGCAAGGCCGGGGTGAGCTGGGATTACAGCAGCTGAATGGGACACTGTCCATCAGGTACCGTCCATCCACATTACTTTTTATACGGTCTTTGACTTCCTTAGAGCTGAAGTCCAGATAACGATTGCTTATCCACTGCACCTCAGACCATCTTTTGGGGGTGGTTGTTTCCACAGCAACTGGAGATCCATCTGCAGCTTGTCCATGCTCCTCCTTTTGATAGCAGCGTCCCAGGCGTGTCTGTGTCCCTTATAAAAACCCAATTTGGTTTCTTTACCCCTAATTTAAAGTGAATTCGTTCTAAGGGTGCCCCCTCCAATGGCCCCACTTAAGGAAAAAAAGGACAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGGCCGCCGCTGCTT