ORFeome > rp9 ORF1 – XORFeome v1.0

rp9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rp9
Gene ID: 6252777
Gene Page ID: 944904
ORF Xenbase ID: 17293977

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123266
Original XGC clone length: 681

Human orthology & disease relationships

NCBI Entrez ID: 6100
Ensembl gene IDs: ENSG00000164610
Directly associated (OMIM) disease MIM numbers: 180104
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ838855
dbEST ID: 79656557
Trimmed Sequence: ATGTCTTGCAGAAGGAAGGAAGAACCAAGAAACAAGCATAGTGTAAAGCACCACAGGAGAGATGAGTATGATGCAGGCAGTCCAGGCAGCACCCACGATCCAGAGCAAGAGCACAGTAGCCGCAAGAGGAGGCGAAGTAGCAGCAGTGGGACCCACACATCACAAGAAATCCAAAAAATCAAGCATGTTGAGACTTTCTATGAAAAACCTCCACCAGGGTTGATCAAGGAAGATGAACCTAAGCCTGAAGACTGTATACCAGATTTGCCTGGCAATGAACATGCCAGAGATTTCTTGGCACATGCTCCAACTAAAGGACTCTGGATGCCACTAGGAAAACAAGTCAAAGTTATGCAGTGTTGGAGGTGTAAGCAGTATGGCCACAGAACCGGTGACCGGGAATGTCCTTATTTTATAAAAGGCAATCAAAAAATTGAACAGTTCAGAGTGGCACATGAAGATCCAATGTATGGTTTGATAAAAAATAAGGAACATGAGGAAAAGCAAATGAGGATCCAGCAGCTTAAAAAGTTATTGGAAGACTCAACCTCTGATGAAAGCAGCAGTTCCAGTTCCGATGACTCTCATAACCAGCCCCAGAAGAAGAAAAAAAAAGAAGAGAAGAAAGAGAAGAAAAGGAAAAGCGCAAGTTTTTCCAGAACCAATCTTCTTCTGATGTGCGACTTTCTTTGTACCAAGTTGCGGTAGTAGAAAACCTTTGCTTATCAATTTTGTTGGCGCCGGACGGGGCCGCTATTAGTTCAAATTA
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTTGCAGAAGGAAGGAAGAACCAAGAAACAAGCATAGTGTAAAGCACCACAGGAGAGATGAGTATGATGCAGGCAGTCCAGGCAGCACCCACGATCCAGAGCAAGAGCACAGTAGCCGCAAGAGGAGGCGAAGTAGCAGCAGTGGGACCCACACATCACAAGAAATCCAAAAAATCAAGCATGTTGAGACTTTCTATGAAAAACCTCCACCAGGGTTGATCAAGGAAGATGAACCTAAGCCTGAAGACTGTATACCAGATTTGCCTGGCAATGAACATGCCAGAGATTTCTTGGCACATGCTCCAACTAAAGGACTCTGGATGCCACTAGGAAAACAAGTCAAAGTTATGCAGTGTTGGAGGTGTAAGCAGTATGGCCACAGAACCGGTGACCGGGAATGTCCTTATTTTATAAAAGGCAATCAAAAAATTGAACAGTTCAGAGTGGCACATGAAGATCCAATGTATGGTTTGATAAAAAATAAGGAACATGAGGAAAAGCAAATGAGGATCCAGCAGCTTAAAAAGTTATTGGAAGACTCAACCTCTGATGAAAGCAGCAGTTCCAGTTCCGATGACTCTCATAACCAGCCCCAGAAGAAGAAAAAAAAAGAAGAGAAGAAAGAGAAGAAAAGGAAAAGCGCAAGTTTTTCCAGAACCAATCTTCTTCTGATGTGCGACTTTCTTTGTACCAAGTTGCGGTAGTAGAAAACCTTTGCTTATCAATTTTGTTGGCGCCGGACGGGGCCGCTATTAGTTCAAATTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTGCAGAAGGAAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838854
dbEST ID: 79656556
Trimmed Sequence: TTCAGAAGAAGATTTGTTCTGTGAATATTTGTGTTTTTTCTTCTTTTTTTTTCTCTTCTCTTTCTTCTTTTTCTTCTTCTTGTGCTTGCTATGAGAGTCATCAGAACTGGAACTGCTGCTTTCATCAGAGGTTGAGTCTTCCAATAACTTTTTAAGCTGCTGGATCCTCATTTGCTTTTCCTCATGTTCCTTATTTTTTATCAAACCATACATTGGATCTTCATGTGCCACTCTGAACTGTTCAATTTTTTGATTGCCTTTTATAAAATAAGGACATTCCCGGTCACCGGTTCTGTGGCCATACTGCTTACACCTCCCACACTGCATAACTTTGACTTGTTTTCCTAGTGGCATCCAGAGTCCTTTAGTTGGAGCATGTGCCAAGAAATCTCTGGCATGTTCATTGCCAGGCAAATCTGGTATACAGTCTTCAGGCTTAGGTTCATCTTCCTTGATCAACCCTGGGTGGAGGTTTTTCATAAAAAGTCTCAACATGCTTGATTTTTTGGATTTCTTGTGATGTGTGGGTCCCACTGCTGCTACTTCTCCTCCCTCTTGCGGCTACAGGGGCTCTTGCTCCGGAATCTGGGTGCCTGCCTGGACGGCCTGCATCCAAACTAAACTCTCCCGGGGGGGGTTTGGCTAGGGCGTGGGTTCTTGTTTCCTTCCCTTCCTTCGCAAAAACATGGTGGCCAACTTTTTGTGTACAAAAGTTGGGGAATTTTAAAAGAA
Full Trace Sequence: AACCAGTGGTAATACCGACTCACTATNAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAGAAGAAGATTTGTTCTGTGAATATTTGTGTTTTTTCTTCTTTTTTTTTCTCTTCTCTTTCTTCTTTTTCTTCTTCTTGTGCTTGCTATGAGAGTCATCAGAACTGGAACTGCTGCTTTCATCAGAGGTTGAGTCTTCCAATAACTTTTTAAGCTGCTGGATCCTCATTTGCTTTTCCTCATGTTCCTTATTTTTTATCAAACCATACATTGGATCTTCATGTGCCACTCTGAACTGTTCAATTTTTTGATTGCCTTTTATAAAATAAGGACATTCCCGGTCACCGGTTCTGTGGCCATACTGCTTACACCTCCCACACTGCATAACTTTGACTTGTTTTCCTAGTGGCATCCAGAGTCCTTTAGTTGGAGCATGTGCCAAGAAATCTCTGGCATGTTCATTGCCAGGCAAATCTGGTATACAGTCTTCAGGCTTAGGTTCATCTTCCTTGATCAACCCTGGGTGGAGGTTTTTCATAAAAAGTCTCAACATGCTTGATTTTTTGGATTTCTTGTGATGTGTGGGTCCCACTGCTGCTACTTCTCCTCCCTCTTGCGGCTACAGGGGCTCTTGCTCCGGAATCTGGGTGCCTGCCTGGACGGCCTGCATCCAAACTAAACTCTCCCGGGGGGGGTTTGGCTAGGGCGTGGGTTCTTGTTTCCTTCCCTTCCTTCGCAAAAACATGGTGGCCAACTTTTTGTGTACAAAAGTTGGGGAATTTTAAAAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAGAAGAAGATTTGTTCTGTGA