ORFeome > rpe65 ORF1 – XORFeome v1.0

rpe65 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpe65
Gene ID: 968704
Gene Page ID: 968699
ORF Xenbase ID: 17294031

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081228
Original XGC clone length: 1614

Human orthology & disease relationships

NCBI Entrez ID: 6121
Ensembl gene IDs: ENSG00000116745
Directly associated (OMIM) disease MIM numbers: 204100,613794
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAAATCATGTGGAGCATCCGGCACGGCTTTACAAAAAACTCTTCCAAACTGCAAAAGATCTGCCAACCCCGATGGCCACCCATGTAACAGGACAAGGTACCCCTTTGGCTATCATGAAGCCTCTTGCGATGTGGGCCTGGTTTATTTGAACTTGGATCAGAACCCTTTTATCACTTATTTGATGGCCAAGCTCTTCTCCATAAGTTTGATATTATAGAGGGACATGTGTCATATCATCGGAAATTAATTAAAAAAAAAAAATAAGTCAGAGTTTTGACATCCCCCCGAGCAAAAAGCAAAGAAGGTAATTCCTCCACAGGCCCGCCGCCCCCAGGTGCCTGTTTACCGGAAACGGGGCAACCCAAAAAACCACCGACCGAAGGGAACTTAGCCTGTTTGGGTTAATACATGGAAGAGGCCCACACCGGCCCAACCCCGACACTTGCCCCAAAGCTTGGTCGAAAGGGGCGGTGGGAACCGCCGCGAGGCGGTTTTTCTGGGTTGGTAAGAACCCTTTTCCCCGGAAAACCCAACCCTCCCCCCTCCCCGGGGTCAAGTTTTTATGCTCGGGGTCCGTTTTTTAATGTAAGCCCCCCCCACCAATTTTAAAATTAAGGGGGACCCGCCGAAGCGAAAATAAACCTTACAAAAGAAAAATGGGGGGCCGAAGACACTCCCCCACCAAAAAAGGGTGTTGGGTGAAACTTCCCCCCCCCCGAGCGAGAAGGGCCGAGAAAAATATTTTAACCGTTTCCCCGGTGAAAGGGGGGCGAGAAACACCAAACATTTTATTTATTTTTTTTTTGATTTCTTTTCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAAATCATGTGGAGCATC

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGCGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTNCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAAGGTTTTTCTGGTCAGGCACTTTTTTGTATTCCGTGGACCGCGAGGAACAACGTGATTTGCCTCGGCTCTGGCTTTTTCGCTCATGTCCTTGTCATCCAAAGATAATCACGAAAGATGGCTTATGTCCCACTGCATTGGCTAACCACTGCACTTAACAATACATCATCATCCTCTTCAATGGCATCTGGTGCCTGGACAAAAATACGCAACTAAAAGGAATGAATTTGGTTCCTGCACCAGCCGGGGTGCAATGAGGCGGGAATTGAACGCGATAACCGGCTCCGCGGCAAAAGGGGCCTGGTGATTGAAAAGGGGGATACCGAAGAAACCCCCCCAGCGAGGGAAATAAGCCTGTTGGGAACGAAATCAGAAGGGGGAGGTCCGGTCGCGATCAGGCACATGTGCCAAAATCTTGGGCGGACGCGGCGGGTGCAGGCGCCGAAATGGCGGGTTTCTGGGCGTGATAGAACGGTCTTGTGGGCGTAAAGACAAGGCCACGGGCTGGCAGAGGTCTGTGTTTTGGAGCCTGGGTTGGTATTTAGATGTAAGGCAGCCCACACCATAATAACCTTATGGGGAGCCCCGGTAAACAAATACAATCTTCAAAAAAGAAAAGGGGGATTCCGGAGCTCCGACCCCACTTNAAATAGTTTTTGGCTTGTGCTCACCGNCTTCTCCAACCAAGGTCCTCGGGACAAATATATTAATTATGTCTCGGTGGGATGGGGGGGAGAGAGCGCGCCACATTGATAATGATTTTTTGTTTTTCTCGGGCCCTCTCGGCCGCCCTGTAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTTTTTCTGGTCAGGCACTT