ORFeome > rph3al ORF1 – XORFeome v1.0

rph3al ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rph3al
Gene ID: 6254325
Gene Page ID: 942973
ORF Xenbase ID: 17294061

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078618
Original XGC clone length: 465

Human orthology & disease relationships

NCBI Entrez ID: 9501
Ensembl gene IDs: ENSG00000181031
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 112600,158350,168600,261550,605909

Library Location

Plate ID: GDExl11005
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ839880
dbEST ID: 79657582
Trimmed Sequence: ATGACAGATACAATTTTTAATAATGGATCAGATCAGTGGGTGTGTCCTAATGACAGACAGCTTGCACTTAGAGCAAAGTTGCATTCTGGTTGGTCTGTGCACACATTTCAAACAGAGAAACAGAGAAAGAATCAGAGCCTGGATCAAAATGAAGTTGATGTAATTCTACAGGTCATCAGAAGAGCTGAAAAAGTGGATACACTGGAACAGCAGAGAATCGGGCGACTTGTGGAGAGATTAGAAAATATGAGGAAAAATGTCATGGGGAATGGAATGTCTCAGTGTTTGCTATGTGGGGAGCTTCTTGGATTCTTAGGCACCACTTCTGTCTTTTGCCAAGACTGTAAAAAGCCGATCTGCTGCTTGAGAGGACAAAGCTTCAGCAAAGGAAACTCTGGAGAATGTAACCTGTTCTATATCTGGCTGCACCTTGGGTGGGACTGTATTGGACTTACTTGTTCCTT
Full Trace Sequence: GCGAGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAGATACAATTTTTAATAATGGATCAGATCAGTGGGTGTGTCCTAATGACAGACAGCTTGCACTTAGAGCAAAGTTGCATTCTGGTTGGTCTGTGCACACATTTCAAACAGAGAAACAGAGAAAGAATCAGAGCCTGGATCAAAATGAAGTTGATGTAATTCTACAGGTCATCAGAAGAGCTGAAAAAGTGGATACACTGGAACAGCAGAGAATCGGGCGACTTGTGGAGAGATTAGAAAATATGAGGAAAAATGTCATGGGGAATGGAATGTCTCAGTGTTTGCTATGTGGGGAGCTTCTTGGATTCTTAGGCACCACTTCTGTCTTTTGCCAAGACTGTAAAAAGCCGATCTGCTGCTTGAGAGGACAAAGCTTCAGCAAAGGAAACTCTGGAGAATGTAACCTGTTCTATATCTGGCTGCACCTTGGGTGGGACTGTATTGGACTTACTTGTTCCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCACTTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAATGAATCATAATAATTGGTTCTTACCAAAAAAAAAAAAAAAAATAAACAATATCCCATATCGGCCCACCCCAACAGCCAAAAAAAAAAAGCCCCTTTCCCGAAACCCCCGTTTCTGGGGTCCGGTTCGTGTGGAGAGGAAAAACGGAAAAAAAAAAGAAAAAAAAAGAAAAATTAATATAGAGAGAATAAAAACCAGAAGGCCCCCCCCCCGGGGCAAAAACCTGCAAAACACCCGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAGATACAATTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839879
dbEST ID: 79657581
Trimmed Sequence: GGAACAAGTAAGTCCAATACAGTCCCACCCAAGGTGCAGCCAGATATAGAACAGGTTACATTCTCCAGAGTTTCCTTTGCTGAAGCTTTGTCCTCTCAAGCAGCAGATCGGCTTTTTACAGTCTTGGCAAAAGACAGAAGTGGTGCCTAAGAATCCAAGAAGCTCCCCACATAGCAAACACTGAGACATTCCATTCCCCATGACATTTTTCCTCATATTTTCTAATCTCTCCACAAGTCGCCCGATTCTCTGCTGTTCCAGTGTATCCACTTTTTCAGCTCTTCTGATGACCTGTAGAATTACATCAACTTCATTTTGATCCAGGCTCTGATTCTTTCTCTGTTTCTCTGTTTGAAATGTGTGCACAGACCAACCAAAATGCAACTTTGCTCTAAGTGCAAGCTGTCTGTCATTAGGACACACCCACTGATCTGATCCATTATTAAAAATTGTATCTGTCATGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAACAAGTAAGTCCAATACAGTCCCACCCAAGGTGCAGCCAGATATAGAACAGGTTACATTCTCCAGAGTTTCCTTTGCTGAAGCTTTGTCCTCTCAAGCAGCAGATCGGCTTTTTACAGTCTTGGCAAAAGACAGAAGTGGTGCCTAAGAATCCAAGAAGCTCCCCACATAGCAAACACTGAGACATTCCATTCCCCATGACATTTTTCCTCATATTTTCTAATCTCTCCACAAGTCGCCCGATTCTCTGCTGTTCCAGTGTATCCACTTTTTCAGCTCTTCTGATGACCTGTAGAATTACATCAACTTCATTTTGATCCAGGCTCTGATTCTTTCTCTGTTTCTCTGTTTGAAATGTGTGCACAGACCAACCAAAATGCAACTTTGCTCTAAGTGCAAGCTGTCTGTCATTAGGACACACCCACTGATCTGATCCATTATTAAAAATTGTATCTGTCATGGTGTCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAATCATTATTTTGGGGCAGAAAAAAAATACAGAACAAAATTTTACACGTAATTGCACAGAAAAAGCCCAAAAAAAAAAAGCGGCCCTCTCCGAACCCCGGGGGTTCCGTGTGCACTTAACTTGGGGGAAAAGAATAACGAGAAAACACAAAAGAAAATAGGGCGGGTTGTGTGAAAATTTAAAGAAAAAAACACGGAAGAGCCCCCCCCCCGNAGTGCGGCCAAAACCCTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAACAAGTAAGTCCAATACAG