ORFeome > rpl12 ORF1 – XORFeome v1.0

rpl12 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rpl12
Gene ID: 1008861
Gene Page ID: 1008854
ORF Xenbase ID: 17294091

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041240
Original XGC clone length: 498

Human orthology & disease relationships

NCBI Entrez ID: 6136
Ensembl gene IDs: ENSG00000197958
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,180105,603896,608688

Library Location

Plate ID: GDExl11009
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ823628
dbEST ID: 79641330
Trimmed Sequence: ATGCCTCCTAAACTCGACCCCAACGAAATTAAAGTCGTGTGCCTGAGATGCACTGGTGGGGAGGTGGGTGCCACTTCTGCTCTGGCCCCGAAAATTGGACCTTTAGGCTTGTCTCCCAAAAAAGTTGGTGATGACATAGCCAAGGCTACCGGTGACTGGAAGGGACTGAGGATCACAGTCAAACTGACCATCCAGAACAGACAAGCTCAGATTGAGGTTGTGCCATCTGCCTCTGCGCTGATCATTAAAGCCCTGAAGGAGCCTCCGCGTGACAGGAAGAAGCAGAAGAACATTAAACACAATGGCAACATCTCCATGGATGAAGTGATAAACATTGCTCGCCAGATGAGGCACCGATCCCTGGCCAGAGAGCTTTCTGGAACCATTAAGGAGATCCTGGGTACAGCACAGTCTGTGGGATGTAATGTAGATGGCAGACACCCCCACGACATCATTGATGACATCAACAGTGGAGAATTGGAGTGCCCAGCAAGCTT
Full Trace Sequence: CCATAGTGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTCCTAAACTCGACCCCAACGAAATTAAAGTCGTGTGCCTGAGATGCACTGGTGGGGAGGTGGGTGCCACTTCTGCTCTGGCCCCGAAAATTGGACCTTTAGGCTTGTCTCCCAAAAAAGTTGGTGATGACATAGCCAAGGCTACCGGTGACTGGAAGGGACTGAGGATCACAGTCAAACTGACCATCCAGAACAGACAAGCTCAGATTGAGGTTGTGCCATCTGCCTCTGCGCTGATCATTAAAGCCCTGAAGGAGCCTCCGCGTGACAGGAAGAAGCAGAAGAACATTAAACACAATGGCAACATCTCCATGGATGAAGTGATAAACATTGCTCGCCAGATGAGGCACCGATCCCTGGCCAGAGAGCTTTCTGGAACCATTAAGGAGATCCTGGGTACAGCACAGTCTGTGGGATGTAATGTAGATGGCAGACACCCCCACGACATCATTGATGACATCAACAGTGGAGAATTGGAGTGCCCAGCAAGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGGTGAGTCGTATTACATGGTCATACGCTGTTTCCTGGCAGCTCTGGCCGTGCCAATTCCTCCAAAATTTTATAAAAAAAAAANTNNTTTTTTTTCCCCCCCTTCCNTTTTTTCCCCTTTTCCCCNNCCCCTATTCCCCTCCCCTTCCTCCCCCNNCCTTTTTCAAATAAATAACCCATTTCTCTCTCATTTCACACAAAACCAAAAAATAAATAAAACGCCTTCTTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTCCTAAACTCGACCCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ828929
dbEST ID: 79646631
Trimmed Sequence: GCTTGCTGGGCACTCCAATTCTCCACTGTTGATGTCATCAATGATGTCGTGGGGGTGTCTGCCATCTACATTACATCCCACAGACTGTGCTGTACCCAGGATCTCCTTAATGGTTCCAGAAAGCTCTCTGGCCAGGGATCGGTGCCTCATCTGGCGAGCAATGTTTATCACTTCATCCATGGAGATGTTGCCATTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCACGCGGAGGCTCCTTCAGGGCTTTAATGATCAGCGCAGAGGCAGATGGCACAACCTCAATCTGAGCTTGTCTGTTCTGGATGGTCAGTTTGACTGTGATCCTCAGTCCCTTCCAGTCACCGGTAGCCTTGGCTATGTCATCACCAACTTTTTTGGGAGACAAGCCTAAAGGTCCAATTTTCGGGGCCAGAGCAGAAGTGGCACCCACCTCCCCACCAGTGCATCTCAGGCACACGACTTTAATTTCGTTGGGGTCGAGTTTAGGAGGCATGG
Full Trace Sequence: GGGCGGGGAAACGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTTGCTGGGCACTCCAATTCTCCACTGTTGATGTCATCAATGATGTCGTGGGGGTGTCTGCCATCTACATTACATCCCACAGACTGTGCTGTACCCAGGATCTCCTTAATGGTTCCAGAAAGCTCTCTGGCCAGGGATCGGTGCCTCATCTGGCGAGCAATGTTTATCACTTCATCCATGGAGATGTTGCCATTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCACGCGGAGGCTCCTTCAGGGCTTTAATGATCAGCGCAGAGGCAGATGGCACAACCTCAATCTGAGCTTGTCTGTTCTGGATGGTCAGTTTGACTGTGATCCTCAGTCCCTTCCAGTCACCGGTAGCCTTGGCTATGTCATCACCAACTTTTTTGGGAGACAAGCCTAAAGGTCCAATTTTCGGGGCCAGAGCAGAAGTGGCACCCACCTCCCCACCAGTGCATCTCAGGCACACGACTTTAATTTCGTTGGGGTCGAGTTTAGGAGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATAATATGAAACCCGAGCTTAAGACTGGACGTCGTTTAAGANCCCCTTTAACACGGGAATTTTACCCGGTTTTCCCCGGAACGAAAATTAAAACTTTTTTATAACGATCCAAAGAGTGGAAACACCAAGAAACAATTTTCCCGGCCCATTTTCCTCCCACAAAAATAATTTTCCCCAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTGCTGGGCACTCCAATTCT