ORFeome > rpl13a ORF1 – XORFeome v1.0

rpl13a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rpl13a
Gene ID: 5862770
Gene Page ID: 5862262
ORF Xenbase ID: 17294109

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043976
Original XGC clone length: 696

Human orthology & disease relationships

NCBI Entrez ID: 23521
Ensembl gene IDs: ENSG00000142541
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11016
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ824281
dbEST ID: 79641983
Trimmed Sequence: ATGGCGGATGCCGCGAATAAGAAGCTCATGCGTGATATTGCCAAGGTTAGCCTTCCTGGACTACACAAGAGCTCTGGGGGCTTCAAGAATGCCAGACAGGTTTTGATCATTGATGGCAGAGGACATCTCCTTGGGCGACTTGCAGCTATTGTTGCCAAGCAGGTTCTGCTGGGTCGCAAAGTGGTGGTAGTTCGATGCGAAGGCATAAACATCTCTGGCAACTTCTACCGCAACAAGCTTAAGTACCTTGCTTTCCTGCGCAAGCGTATGAACACCAACCCATCACGGGGACCATACCATTTCAGAGCACCCAGCCGCATCTTCTGGAGGACCGTAAGAGGAATGCTGCCACATAAGACAAAGAGAGGCCAGGCTGCTCTGGAGCGACTGAAGGTGTTTGATGGAATCCCACCTCCCTATGACAAGAGGAAGCGTATGGTGGTTCCTGCTGCTCTGAAGATTGTGCGCCTGAAGCCAACACGGAAGTTTGCTTTCCTTGGCCGCCTTGCCCATGAAGTTGGCTGGAAATACCAGGCAGTGACTGCAACCCTGGAGGAGAAGAGAAAGGAGAAGGCCAAGATTCATTATAACAAAAAGAAGATCATTGGGAAACTTCGGAGACAAGCAGAAAAGAACGTTGAGAGCAAAATCTCCAAATACACAGATGTTCTGAAAACATACGGCATACTTGTCTTGGCAAA
Full Trace Sequence: GGGCCTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGATGCCGCGAATAAGAAGCTCATGCGTGATATTGCCAAGGTTAGCCTTCCTGGACTACACAAGAGCTCTGGGGGCTTCAAGAATGCCAGACAGGTTTTGATCATTGATGGCAGAGGACATCTCCTTGGGCGACTTGCAGCTATTGTTGCCAAGCAGGTTCTGCTGGGTCGCAAAGTGGTGGTAGTTCGATGCGAAGGCATAAACATCTCTGGCAACTTCTACCGCAACAAGCTTAAGTACCTTGCTTTCCTGCGCAAGCGTATGAACACCAACCCATCACGGGGACCATACCATTTCAGAGCACCCAGCCGCATCTTCTGGAGGACCGTAAGAGGAATGCTGCCACATAAGACAAAGAGAGGCCAGGCTGCTCTGGAGCGACTGAAGGTGTTTGATGGAATCCCACCTCCCTATGACAAGAGGAAGCGTATGGTGGTTCCTGCTGCTCTGAAGATTGTGCGCCTGAAGCCAACACGGAAGTTTGCTTTCCTTGGCCGCCTTGCCCATGAAGTTGGCTGGAAATACCAGGCAGTGACTGCAACCCTGGAGGAGAAGAGAAAGGAGAAGGCCAAGATTCATTATAACAAAAAGAAGATCATTGGGAAACTTCGGAGACAAGCAGAAAAGAACGTTGAGAGCAAAATCTCCAAATACACAGATGTTCTGAAAACATACGGCATACTTGTCTTGGCAAACTTCCTTGTACAAAGTTGGCAATTAATAGAAAAGCATTGCTTTATCAATTTGGTTTGCAACCGAACAGGGTTCACTATTCAAGTCAAAAATAAAAATCATTTCTTTTGCCCAGTCCCGGCCTGAATATCTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGATGCCGCGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829618
dbEST ID: 79647320
Trimmed Sequence: GACAAGTATGCCGTATTGTTTCAGAACATCTGTGTATTTGGAGATTTTGCTCTCAACGTTCTTTTCTGCTTGTCTCCGAAGTTTCCCAATGATCTTCTTTTTGTTATAATGAATCTTGGCCTTCTCCTTTCTCTTCTCCTCCAGGGTTGCAGTCACTGCCTGGTATTTCCAGCCAACTTCATGGGCAAGGCGGCCAAGGAAAGCAAACTTCCGTGTTGGCTTCAGGCGCACAATCTTCAGAGCAGCAGGAACCACCATACGCTTCCTCTTGTCATAGGGAGGTGGGATTCCATCAAACACCTTCAGTCGCTCCAGAGCAGCCTGGCCTCTCTTTGTCTTATGTGGCAGCATTCCTCTTACGGTCCTCCAGAAGATGCGGCTGGGTGCTCTGAAATGGTATGGTCCCCGTGATGGGTTGGTGTTCATACGCTTGCGCAGGAAAGCAAGGTACTTAAGCTTGTTGCGGTAGAAGTTGCCAGAGATGTTTATGCCTTCGCATCGAACTACCACCACTTTGCGACCCAGCAGAACCTGCTTGGCAACAATAGCTGCAAGTCGCCCAAGGAGATGTCCTCTGCCATCAATGATCAAAACCTGTCTGGCATTCTTGAAGCCCCCAGAGCTCCTGTGTAGTCCAGGAAGGCTAACCCTGGGCAATATCACGCCAGGAACTTCTTATTCCCCGGCCATCCGCCTGGGTGGCCCAACTTTTTTGTGTACAAGGTTTGGGGATTTATAAAAAAAAAATTTTGCCTCCAATTAAATT
Full Trace Sequence: TGCCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACAAGTATGCCGTATTGTTTCAGAACATCTGTGTATTTGGAGATTTTGCTCTCAACGTTCTTTTCTGCTTGTCTCCGAAGTTTCCCAATGATCTTCTTTTTGTTATAATGAATCTTGGCCTTCTCCTTTCTCTTCTCCTCCAGGGTTGCAGTCACTGCCTGGTATTTCCAGCCAACTTCATGGGCAAGGCGGCCAAGGAAAGCAAACTTCCGTGTTGGCTTCAGGCGCACAATCTTCAGAGCAGCAGGAACCACCATACGCTTCCTCTTGTCATAGGGAGGTGGGATTCCATCAAACACCTTCAGTCGCTCCAGAGCAGCCTGGCCTCTCTTTGTCTTATGTGGCAGCATTCCTCTTACGGTCCTCCAGAAGATGCGGCTGGGTGCTCTGAAATGGTATGGTCCCCGTGATGGGTTGGTGTTCATACGCTTGCGCAGGAAAGCAAGGTACTTAAGCTTGTTGCGGTAGAAGTTGCCAGAGATGTTTATGCCTTCGCATCGAACTACCACCACTTTGCGACCCAGCAGAACCTGCTTGGCAACAATAGCTGCAAGTCGCCCAAGGAGATGTCCTCTGCCATCAATGATCAAAACCTGTCTGGCATTCTTGAAGCCCCCAGAGCTCCTGTGTAGTCCAGGAAGGCTAACCCTGGGCAATATCACGCCAGGAACTTCTTATTCCCCGGCCATCCGCCTGGGTGGCCCAACTTTTTTGTGTACAAGGTTTGGGGATTTATAAAAAAAAAATTTTGCCTCCAATTAAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACAAGTATGCCGTATTGTTTCAG