ORFeome > rpl17 ORF2 – XORFeome v1.0

rpl17 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rpl17
Gene ID: 5859923
Gene Page ID: 5859416
ORF Xenbase ID: 17294133

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123118
Original XGC clone length: 555

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ838114
dbEST ID: 79655816
Trimmed Sequence: ATGGTGCGCTATTCTCTCGACCCGGAGAACCCCACAAAATCATGCAAAGCACGGGGCTCAAATCTTCGGGTGCACTTTAAGAACACTCGTGAAACTGCTCAAGCTATTAAAGGAATGCATATCCGTAAAGCCTCCAAATATCTGAAAGATGTCACCCTGAAGAAGCAGTGCGTTCCTTTCCGCCGCTACAATGGTGGTGTTGGAAGGTGTGCCCAGGCTAAGCAGTGGGACTGGACACAGGGACGCTGGCCAAAAAAGAGCGCAAACTTCCTCCTGCACATGCTGAAAAATGCCGAAAGCAATGCAGAGGTTAAGGGTTTGGATGTTGATTCCTTGGTCATTGAGCACATCCAGGTGAATAAGGCCCCCAAGATGCGCAGACGTACCTACCGCGCTCATGGTCGCATCAACCCCTACATGAGCTCCCCGTGTCACATCGAAATGATCCTTACTGAGAAGGAACAGATTGTCCCCAAACCTGAGGAGGAAGTTGCTCAAAAGAAAAAGATCTCTCAGAAGAAGCTGAAAAAGCAGAAACTTATGGCTCGGGAATT
Full Trace Sequence: TTCGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGCGCTATTCTCTCGACCCGGAGAACCCCACAAAATCATGCAAAGCACGGGGCTCAAATCTTCGGGTGCACTTTAAGAACACTCGTGAAACTGCTCAAGCTATTAAAGGAATGCATATCCGTAAAGCCTCCAAATATCTGAAAGATGTCACCCTGAAGAAGCAGTGCGTTCCTTTCCGCCGCTACAATGGTGGTGTTGGAAGGTGTGCCCAGGCTAAGCAGTGGGACTGGACACAGGGACGCTGGCCAAAAAAGAGCGCAAACTTCCTCCTGCACATGCTGAAAAATGCCGAAAGCAATGCAGAGGTTAAGGGTTTGGATGTTGATTCCTTGGTCATTGAGCACATCCAGGTGAATAAGGCCCCCAAGATGCGCAGACGTACCTACCGCGCTCATGGTCGCATCAACCCCTACATGAGCTCCCCGTGTCACATCGAAATGATCCTTACTGAGAAGGAACAGATTGTCCCCAAACCTGAGGAGGAAGTTGCTCAAAAGAAAAAGATCTCTCAGAAGAAGCTGAAAAAGCAGAAACTTATGGCTCGGGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCAATAGTGAGTCTTATTTCAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAGAACATAGTTCAACATCCATCCAAAAGTAACAAGAGAGGGTTTTTTTTTGCGGGGCGGGGGGGGGGGGGGGGGGGGGCCCTTTTTTTGGTAATTAAGTGTAGGCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCGCTATTCTCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838113
dbEST ID: 79655815
Trimmed Sequence: TTCCCGAGCCATAAGTTTCTGCTTTTTCAGCTTCTTCTGAGAGATCTTTTTCTTTTGAGCAACTTCCTCCTCAGGTTTGGGGACAATCTGTTCCTTCTCAGTAAGGATCATTTCGATGTGACACGGGGAGCTCATGTAGGGGTTGATGCGACCATGAGCGCGGTAGGTACGTCTGCGCATCTTGGGGGCCTTATTCACCTGGATGTGCTCAATGACCAAGGAATCAACATCCAAACCCTTAACCTCTGCATTGCTTTCGGCATTTTTCAGCATGTGCAGGAGGAAGTTTGCGCTCTTTTTTGGCCAGCGTCCCTGTGTCCAGTCCCACTGCTTAGCCTGGGCACACCTTCCAACACCACCATTGTAGCGGCGGAAAGGAACGCACTGCTTCTTCAGGGTGACATCTTTCAGATATTTGGAGGCTTTACGGATATGCATTCCTTTAATAGCTTGAGCAGTTTCACGAGTGTTCTTAAAGTGCACCCGAAGATTTAAGCCCCGTGCTTTGCATGATTTTGTGGGGTTCTCCGGGTCGAAAGAATAGCGCACCATGG
Full Trace Sequence: GGGGAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCCGAGCCATAAGTTTCTGCTTTTTCAGCTTCTTCTGAGAGATCTTTTTCTTTTGAGCAACTTCCTCCTCAGGTTTGGGGACAATCTGTTCCTTCTCAGTAAGGATCATTTCGATGTGACACGGGGAGCTCATGTAGGGGTTGATGCGACCATGAGCGCGGTAGGTACGTCTGCGCATCTTGGGGGCCTTATTCACCTGGATGTGCTCAATGACCAAGGAATCAACATCCAAACCCTTAACCTCTGCATTGCTTTCGGCATTTTTCAGCATGTGCAGGAGGAAGTTTGCGCTCTTTTTTGGCCAGCGTCCCTGTGTCCAGTCCCACTGCTTAGCCTGGGCACACCTTCCAACACCACCATTGTAGCGGCGGAAAGGAACGCACTGCTTCTTCAGGGTGACATCTTTCAGATATTTGGAGGCTTTACGGATATGCATTCCTTTAATAGCTTGAGCAGTTTCACGAGTGTTCTTAAAGTGCACCCGAAGATTTAAGCCCCGTGCTTTGCATGATTTTGTGGGGTTCTCCGGGTCGAAAGAATAGCGCACCATGGTGCCAACTTTTCTGTAACAAGTTGGCATTATAAAAAACATTGGTTCTTCATTTTTTTGCACGAACAGGTCACTTACAGTTCGAATTAAATAAATAAATAAAAAAAAAAGATTAAGAAACAGACATCGTTTTCAAGCTCCCATAAAACGGGGGGGTGGGGNAAAGAAAAAAANNGGGGGGGGGGAGGGGGGGGGGGGGGGGTTTCTTAAGATGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCCGAGCCATAAGTTTC