ORFeome > rpl18 ORF1 – XORFeome v1.0

rpl18 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl18
Gene ID: 6255773
Gene Page ID: 1006302
ORF Xenbase ID: 17294139

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053773
Original XGC clone length: 567

Human orthology & disease relationships

NCBI Entrez ID: 6141
Ensembl gene IDs: ENSG00000063177
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 154500,253300,253400,253550,600334,603689,603896,604145,608807,608808

Library Location

Plate ID: GDExl11001
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ839229
dbEST ID: 79656931
Trimmed Sequence: ATGGGAATAGATATCCGTCACAACAAGGACCGCAAGGTGCGGCGAAAGGAGCCCAAGAGCCAGGATATCTATCTGAGGCTTTTAGTAAAGCTTTATCGATTCTTGGCTCGTCGTACCAACTCCAGTTTCAACCGGGTGGTTCTGAAGCGTCTGTTCATGAGCCGAACCAACAGGCCACCCCTCTCTATGTCCCGTCTTATTCGCAAAATGAAATTGCAAGGACGTGAAAACAAGACTGCAGTGGTTGTGGGCTGTATCACAGATGATGTCAGGATCCATGATATCCCCAAACTGAAGGTGTGCGCACTTAAAATAACCAGCGGAGCACGTAGCCGAATCCTGAAGTCTGGAGGTCAGATTATGACGTTTGATCAGCTCGCCCTTGCGGCCCCTAAAGGCCAGAACACTGTTCTTCTTTCAGGACCTCGTAAGGCCCGTGAAGTATACAGACACTTTGGGAAGGCACCTGGTACTCCACACAGTCGCACTAAGCCTTATGTGCTCTCCAAGGGTAGAAAGTTTGAGCGCGCCAGAGGACGCAAAGCCAGCAGAGGATACAAGAACTT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAATAGATATCCGTCACAACAAGGACCGCAAGGTGCGGCGAAAGGAGCCCAAGAGCCAGGATATCTATCTGAGGCTTTTAGTAAAGCTTTATCGATTCTTGGCTCGTCGTACCAACTCCAGTTTCAACCGGGTGGTTCTGAAGCGTCTGTTCATGAGCCGAACCAACAGGCCACCCCTCTCTATGTCCCGTCTTATTCGCAAAATGAAATTGCAAGGACGTGAAAACAAGACTGCAGTGGTTGTGGGCTGTATCACAGATGATGTCAGGATCCATGATATCCCCAAACTGAAGGTGTGCGCACTTAAAATAACCAGCGGAGCACGTAGCCGAATCCTGAAGTCTGGAGGTCAGATTATGACGTTTGATCAGCTCGCCCTTGCGGCCCCTAAAGGCCAGAACACTGTTCTTCTTTCAGGACCTCGTAAGGCCCGTGAAGTATACAGACACTTTGGGAAGGCACCTGGTACTCCACACAGTCGCACTAAGCCTTATGTGCTCTCCAAGGGTAGAAAGTTTGAGCGCGCCAGAGGACGCAAAGCCAGCAGAGGATACAAGAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCACCTGATATCCCCTATTGTGAGTCCTAATACGAAAAAAAAGAAATAATTCAGAAAACCCTTGGCCCCGGATCTCAAACCATGTCGAGGATTACAAACGAAAAAGGGGGGCN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAATAGATATCCGTCACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839228
dbEST ID: 79656930
Trimmed Sequence: GTTCTTGTATCCTCTGCTGGCTCTGCGTCCTCTGGCGCGCTCAAACTTTCTACCCTTGGAGAGCACATAAGGCTTAGTGCGACTGTGTGGAGTACCAGGTGCCTTCCCAAAGTGTCTGTATACTTCACGGGCCTTACGAGGTCCTGAAAGAAGAACAGTGTTCTGGCCTTTAGGGGCCGCAAGGGCGAGCTGATCAAACGTCATAATCTGACCTCCAGACTTCAGGATTCGGCTACGTGCTCCGCTGGTTATTTTAAGTGCGCACACCTTCAGTTTGGGGATATCATGGATCCTGACATCATCTGTGATACAGCCCACAACCACTGCAGTCTTGTTTTCACGTCCTTGCAATTTCATTTTGCGAATAAGACGGGACATAGAGAGGGGTGGCCTGTTGGTTCGGCTCATGAACAGACGCTTCAGAACCACCCGGTTGAAACTGGAGTTGGTACGACGAGCCAAGAATCAATAAAGCTTTACTAAAAGCCTCAGATAGATATCCTGGCTCTTGGGCTCCTTTCGCCCCACCTTGCGGTCCTTGTTGTGAAAGATATCTATTTCCAATGG
Full Trace Sequence: GCCGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTCTTGTATCCTCTGCTGGCTCTGCGTCCTCTGGCGCGCTCAAACTTTCTACCCTTGGAGAGCACATAAGGCTTAGTGCGACTGTGTGGAGTACCAGGTGCCTTCCCAAAGTGTCTGTATACTTCACGGGCCTTACGAGGTCCTGAAAGAAGAACAGTGTTCTGGCCTTTAGGGGCCGCAAGGGCGAGCTGATCAAACGTCATAATCTGACCTCCAGACTTCAGGATTCGGCTACGTGCTCCGCTGGTTATTTTAAGTGCGCACACCTTCAGTTTGGGGATATCATGGATCCTGACATCATCTGTGATACAGCCCACAACCACTGCAGTCTTGTTTTCACGTCCTTGCAATTTCATTTTGCGAATAAGACGGGACATAGAGAGGGGTGGCCTGTTGGTTCGGCTCATGAACAGACGCTTCAGAACCACCCGGTTGAAACTGGAGTTGGTACGACGAGCCAAGAATCAATAAAGCTTTACTAAAAGCCTCAGATAGATATCCTGGCTCTTGGGCTCCTTTCGCCCCACCTTGCGGTCCTTGTTGTGAAAGATATCTATTTCCAATGGTGCCAACTTTTTTGGTAACAAATTGGCATTTATAAAAAGCCATGGCTCATCAATTTGTTGCAAACAAACAGGTCCCTATCAGTCAAAAAAAAAAAAATAATAAGCAGCCCGGAACTTAACAACGAACCATTCTTTTTCAAGGGCCCTGGAACGGAGGGTTTTTCCCTGCCCGAAGTTATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCTTGTATCCTCTGCTGGCT